EMAIL THIS PAGE TO A FRIEND

LTB

lymphotoxin beta (TNF superfamily, member 3)

Synonyms: TNFC TNFSF3 p33
UniProtKB ID: Q06643, P78370, Q52LU8, Q99761
Gene ID:
Human(4050) Summary: Lymphotoxin beta is a type II membrane protein of the TNF family. It anchors lymphotoxin-alpha to the cell surface through heterotrimer formation. The predominant form on the lymphocyte surface is the lymphotoxin-alpha 1/beta 2 complex (e.g. 1 molecule alpha/2 molecules beta) and this complex is the primary ligand for the lymphotoxin-beta receptor. The minor complex is lymphotoxin-alpha 2/beta 1. LTB is an inducer of the inflammatory response system and involved in normal development of lymphoid tissue. Lymphotoxin-beta isoform b is unable to complex with lymphotoxin-alpha suggesting a function for lymphotoxin-beta which is independent of lympyhotoxin-alpha. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(16994) lymphotoxin B
Rat(361795) lymphotoxin beta (TNF superfamily, member 3)
sheep(101122820) lymphotoxin beta (TNF superfamily, member 3)
domestic guinea pig(100722556) lymphotoxin beta (TNF superfamily, member 3)
naked mole-rat(101716941) lymphotoxin beta (TNF superfamily, member 3)
dog(481712) lymphotoxin beta (TNF superfamily, member 3)
domestic cat(101085208) lymphotoxin beta (TNF superfamily, member 3)
cow(529757) lymphotoxin beta (TNF superfamily, member 3)
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002341 Rosetta Predictions human pricing
NM_009588 Rosetta Predictions human pricing
NM_212507 Rosetta Predictions rat pricing
NM_008518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125334 predicted 656
2 SASI_Hs01_00125335 predicted 820
3 SASI_Hs01_00125336 predicted 816
4 SASI_Hs01_00125337 predicted 825
5 SASI_Hs01_00125340 predicted 279
6 SASI_Hs01_00125341 predicted 336
7 SASI_Hs01_00125342 predicted 740
8 SASI_Hs01_00125343 predicted 684
9 SASI_Hs02_00333661 predicted 273
10 SASI_Hs02_00333662 predicted 335
11 SASI_Hs01_00125338 predicted 400
12 SASI_Hs01_00125339 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207394 predicted 607
2 SASI_Hs01_00207397 predicted 235
3 SASI_Hs01_00207398 predicted 289
4 SASI_Hs01_00207399 predicted 690
5 SASI_Hs01_00207400 predicted 151
6 SASI_Hs01_00207401 predicted 639
7 SASI_Hs01_00207402 predicted 232
8 SASI_Hs02_00343514 predicted 110
9 SASI_Hs02_00343515 predicted 293
10 SASI_Hs02_00343516 predicted 779
11 SASI_Hs01_00207395 predicted 353
12 SASI_Hs01_00207396 predicted 349
13 SASI_Hs01_00207403 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044227 predicted 657
2 SASI_Rn01_00044228 predicted 241
3 SASI_Rn01_00044230 predicted 366
4 SASI_Rn01_00044231 predicted 461
5 SASI_Rn01_00044232 predicted 598
6 SASI_Rn01_00044233 predicted 598
7 SASI_Rn01_00044234 predicted 910
8 SASI_Rn01_00044235 predicted 228
9 SASI_Rn01_00044236 predicted 358
10 SASI_Rn02_00270500 predicted 422
11 SASI_Rn01_00044229 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175635 predicted 589
2 SASI_Mm01_00175636 predicted 526
3 SASI_Mm01_00175637 predicted 246
4 SASI_Mm01_00175638 predicted 354
5 SASI_Mm02_00314094 predicted 380
6 SASI_Mm01_00175639 predicted 530
7 SASI_Mm01_00175641 predicted 363
8 SASI_Mm01_00175642 predicted 752
9 SASI_Mm01_00175643 predicted 361
10 SASI_Mm01_00175644 predicted 498
11 SASI_Mm01_00175640 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002341
LTB MISSION shRNA Bacterial Glycerol Stock
lymphotoxin beta (TNF superfamily, member 3)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-702s1c1
Sequence:CCGGGCGAGAGGGAAGACCTTCTTTCTCGAGAAAGAAGGTCTTCCCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-410s1c1
Sequence:CCGGCCTCTACTGTCTCGTCGGCTACTCGAGTAGCCGACGAGACAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-324s1c1
Sequence:CCGGACGACGAAGGAACAGGCGTTTCTCGAGAAACGCCTGTTCCTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-86s1c1
Sequence:CCGGCACTTCTCTGGTGACCTTGTTCTCGAGAACAAGGTCACCAGAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-656s1c1
Sequence:CCGGCGAGAGGGTGTACGTCAACATCTCGAGATGTTGACGTACACCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002341.1-688s21c1
Sequence:CCGGATATGGTGGACTTCGCGAGAGCTCGAGCTCTCGCGAAGTCCACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002341.1-395s21c1
Sequence:CCGGGGACGGCCTCTATTACCTCTACTCGAGTAGAGGTAATAGAGGCCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002341.1-326s21c1
Sequence:CCGGGACGAAGGAACAGGCGTTTCTCTCGAGAGAAACGCCTGTTCCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002341
LTB MISSION shRNA shRNA Plasmid DNA
lymphotoxin beta (TNF superfamily, member 3)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-702s1c1
Sequence:CCGGGCGAGAGGGAAGACCTTCTTTCTCGAGAAAGAAGGTCTTCCCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-410s1c1
Sequence:CCGGCCTCTACTGTCTCGTCGGCTACTCGAGTAGCCGACGAGACAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-324s1c1
Sequence:CCGGACGACGAAGGAACAGGCGTTTCTCGAGAAACGCCTGTTCCTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-86s1c1
Sequence:CCGGCACTTCTCTGGTGACCTTGTTCTCGAGAACAAGGTCACCAGAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-656s1c1
Sequence:CCGGCGAGAGGGTGTACGTCAACATCTCGAGATGTTGACGTACACCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002341.1-688s21c1
Sequence:CCGGATATGGTGGACTTCGCGAGAGCTCGAGCTCTCGCGAAGTCCACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002341.1-395s21c1
Sequence:CCGGGGACGGCCTCTATTACCTCTACTCGAGTAGAGGTAATAGAGGCCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002341.1-326s21c1
Sequence:CCGGGACGAAGGAACAGGCGTTTCTCTCGAGAGAAACGCCTGTTCCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002341
LTB MISSION shRNA Lentiviral Transduction Particles
lymphotoxin beta (TNF superfamily, member 3)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-702s1c1
Sequence:CCGGGCGAGAGGGAAGACCTTCTTTCTCGAGAAAGAAGGTCTTCCCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-410s1c1
Sequence:CCGGCCTCTACTGTCTCGTCGGCTACTCGAGTAGCCGACGAGACAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-324s1c1
Sequence:CCGGACGACGAAGGAACAGGCGTTTCTCGAGAAACGCCTGTTCCTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-86s1c1
Sequence:CCGGCACTTCTCTGGTGACCTTGTTCTCGAGAACAAGGTCACCAGAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002341.1-656s1c1
Sequence:CCGGCGAGAGGGTGTACGTCAACATCTCGAGATGTTGACGTACACCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002341.1-688s21c1
Sequence:CCGGATATGGTGGACTTCGCGAGAGCTCGAGCTCTCGCGAAGTCCACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002341.1-395s21c1
Sequence:CCGGGGACGGCCTCTATTACCTCTACTCGAGTAGAGGTAATAGAGGCCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002341.1-326s21c1
Sequence:CCGGGACGAAGGAACAGGCGTTTCTCTCGAGAGAAACGCCTGTTCCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008518
VALIDATED
LTB MISSION shRNA Bacterial Glycerol Stock
lymphotoxin beta (TNF superfamily, member 3)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-157s1c1
Sequence:CCGGCGTCGGGTTGAGAAGATCATTCTCGAGAATGATCTTCTCAACCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-299s1c1
Sequence:CCGGCCAGGAATCTAGCCTCCACATCTCGAGATGTGGAGGCTAGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-518s1c1
Sequence:CCGGGCCAAGAAGAAGCGTTTCTGACTCGAGTCAGAAACGCTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-739s1c1
Sequence:CCGGGCGGAGACAGTCACACCTGTTCTCGAGAACAGGTGTGACTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-834s1c1
Sequence:CCGGCGAGAGGGTCTACGTTAACATCTCGAGATGTTAACGTAGACCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-533s21c1
Sequence:CCGGGCCAAGAAGAAGCGTTTCTGACTCGAGTCAGAAACGCTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-314s21c1
Sequence:CCGGCCAGGAATCTAGCCTCCACATCTCGAGATGTGGAGGCTAGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-849s21c1
Sequence:CCGGCGAGAGGGTCTACGTTAACATCTCGAGATGTTAACGTAGACCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-754s21c1
Sequence:CCGGGCGGAGACAGTCACACCTGTTCTCGAGAACAGGTGTGACTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008518
VALIDATED
LTB MISSION shRNA shRNA Plasmid DNA
lymphotoxin beta (TNF superfamily, member 3)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-157s1c1
Sequence:CCGGCGTCGGGTTGAGAAGATCATTCTCGAGAATGATCTTCTCAACCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-299s1c1
Sequence:CCGGCCAGGAATCTAGCCTCCACATCTCGAGATGTGGAGGCTAGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-518s1c1
Sequence:CCGGGCCAAGAAGAAGCGTTTCTGACTCGAGTCAGAAACGCTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-739s1c1
Sequence:CCGGGCGGAGACAGTCACACCTGTTCTCGAGAACAGGTGTGACTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-834s1c1
Sequence:CCGGCGAGAGGGTCTACGTTAACATCTCGAGATGTTAACGTAGACCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-533s21c1
Sequence:CCGGGCCAAGAAGAAGCGTTTCTGACTCGAGTCAGAAACGCTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-314s21c1
Sequence:CCGGCCAGGAATCTAGCCTCCACATCTCGAGATGTGGAGGCTAGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-849s21c1
Sequence:CCGGCGAGAGGGTCTACGTTAACATCTCGAGATGTTAACGTAGACCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-754s21c1
Sequence:CCGGGCGGAGACAGTCACACCTGTTCTCGAGAACAGGTGTGACTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008518
VALIDATED
LTB MISSION shRNA Lentiviral Transduction Particles
lymphotoxin beta (TNF superfamily, member 3)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-157s1c1
Sequence:CCGGCGTCGGGTTGAGAAGATCATTCTCGAGAATGATCTTCTCAACCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-299s1c1
Sequence:CCGGCCAGGAATCTAGCCTCCACATCTCGAGATGTGGAGGCTAGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-518s1c1
Sequence:CCGGGCCAAGAAGAAGCGTTTCTGACTCGAGTCAGAAACGCTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-739s1c1
Sequence:CCGGGCGGAGACAGTCACACCTGTTCTCGAGAACAGGTGTGACTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008518.1-834s1c1
Sequence:CCGGCGAGAGGGTCTACGTTAACATCTCGAGATGTTAACGTAGACCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-533s21c1
Sequence:CCGGGCCAAGAAGAAGCGTTTCTGACTCGAGTCAGAAACGCTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-314s21c1
Sequence:CCGGCCAGGAATCTAGCCTCCACATCTCGAGATGTGGAGGCTAGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-849s21c1
Sequence:CCGGCGAGAGGGTCTACGTTAACATCTCGAGATGTTAACGTAGACCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008518.2-754s21c1
Sequence:CCGGGCGGAGACAGTCACACCTGTTCTCGAGAACAGGTGTGACTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks