EMAIL THIS PAGE TO A FRIEND

LTBP1

latent transforming growth factor beta binding protein 1

Gene ID:
Human(4052) Summary: The protein encoded by this gene belongs to the family of latent TGF-beta binding proteins (LTBPs). The secretion and activation of TGF-betas is regulated by their association with latency-associated proteins and with latent TGF-beta binding proteins. The product of this gene targets latent complexes of transforming growth factor beta to the extracellular matrix, where the latent cytokine is subsequently activated by several different mechanisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(268977) latent transforming growth factor beta binding protein 1
Rat(59107) latent transforming growth factor beta binding protein 1
domestic guinea pig(100733334) latent transforming growth factor beta binding protein 1
naked mole-rat(101715513) latent transforming growth factor beta binding protein 1
sheep(101102219) latent transforming growth factor beta binding protein 1
Zebrafish(562180) latent transforming growth factor beta binding protein 1
dog(475720) latent transforming growth factor beta binding protein 1
chicken(421461) latent transforming growth factor beta binding protein 1
cow(510559) latent transforming growth factor beta binding protein 1
Horse(100070522) latent transforming growth factor beta binding protein 1
domestic cat(101084534) latent transforming growth factor beta binding protein 1
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000627 Rosetta Predictions human pricing
NM_206943 Rosetta Predictions human pricing
NM_021587 Rosetta Predictions rat pricing
NM_019919 Rosetta Predictions mouse pricing
NM_206958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187276 predicted 1038
2 SASI_Hs02_00302968 predicted 1179
3 SASI_Hs01_00187277 predicted 2694
4 SASI_Hs02_00302969 predicted 2276
5 SASI_Hs02_00302970 predicted 587
6 SASI_Hs02_00302971 predicted 2486
7 SASI_Hs01_00187280 predicted 825
8 SASI_Hs02_00302972 predicted 3510
9 SASI_Hs01_00187282 predicted 1112
10 SASI_Hs01_00187283 predicted 3499
11 SASI_Hs01_00187278 predicted 1842
12 SASI_Hs01_00187279 predicted 3198
13 SASI_Hs01_00187281 predicted 464
14 SASI_Hs01_00187284 predicted 2309
15 SASI_Hs01_00187285 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168991 predicted 1887
2 SASI_Hs02_00373640 predicted 2030
3 SASI_Hs01_00168992 predicted 3543
4 SASI_Hs02_00373641 predicted 3126
5 SASI_Hs02_00373642 predicted 1434
6 SASI_Hs02_00373643 predicted 3335
7 SASI_Hs01_00168995 predicted 1683
8 SASI_Hs02_00373644 predicted 4360
9 SASI_Hs01_00168997 predicted 1957
10 SASI_Hs01_00168998 predicted 4357
11 SASI_Hs01_00168993 predicted 2686
12 SASI_Hs01_00168994 predicted 4042
13 SASI_Hs01_00168996 predicted 1318
14 SASI_Hs01_00168999 predicted 3151
15 SASI_Hs01_00169000 predicted 2416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082105 predicted 2983
2 SASI_Rn01_00082106 predicted 5224
3 SASI_Rn02_00262628 predicted 4614
4 SASI_Rn01_00082108 predicted 2506
5 SASI_Rn01_00082109 predicted 3157
6 SASI_Rn01_00082110 predicted 5378
7 SASI_Rn01_00082111 predicted 5402
8 SASI_Rn01_00082112 predicted 5119
9 SASI_Rn01_00082113 predicted 2106
10 SASI_Rn01_00082114 predicted 1618
11 SASI_Rn01_00082107 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166411 predicted 2221
2 SASI_Mm01_00166412 predicted 3671
3 SASI_Mm01_00166413 predicted 2010
4 SASI_Mm01_00166414 predicted 3014
5 SASI_Mm01_00166415 predicted 5083
6 SASI_Mm01_00166416 predicted 4679
7 SASI_Mm01_00166417 predicted 2227
8 SASI_Mm01_00166418 predicted 1638
9 SASI_Mm01_00166419 predicted 2129
10 SASI_Mm01_00166420 predicted 4652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136740 predicted 1006
2 SASI_Mm01_00136741 predicted 2462
3 SASI_Mm01_00136742 predicted 804
4 SASI_Mm01_00136743 predicted 1798
5 SASI_Mm01_00136744 predicted 3872
6 SASI_Mm01_00136745 predicted 3467
7 SASI_Mm01_00136746 predicted 1021
8 SASI_Mm01_00136747 predicted 427
9 SASI_Mm01_00136748 predicted 919
10 SASI_Mm01_00136749 predicted 3445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000627
VALIDATED
LTBP1 MISSION shRNA Bacterial Glycerol Stock
latent transforming growth factor beta binding protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-4124s21c1
Sequence:CCGGGATGACCTGTGTCGATGTAAACTCGAGTTTACATCGACACAGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-1701s21c1
Sequence:CCGGCCTGTTGAAGTAGCTCCTGAACTCGAGTTCAGGAGCTACTTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000627.2-4272s1c3
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-2718s21c1
Sequence:CCGGCCGGATGGATTTCAGCTAGATCTCGAGATCTAGCTGAAATCCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-4272s21c1
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-4568s21c1
Sequence:CCGGGGTGGAACAGTGCTGTTATTTCTCGAGAAATAACAGCACTGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-631s1c1
Sequence:CCGGCCGTCCAGATACATCAGGTTTCTCGAGAAACCTGATGTATCTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-4030s1c1
Sequence:CCGGGCATCCTCAATGGATGTGAAACTCGAGTTTCACATCCATTGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-2718s1c1
Sequence:CCGGCCGGATGGATTTCAGCTAGATCTCGAGATCTAGCTGAAATCCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-1701s1c1
Sequence:CCGGCCTGTTGAAGTAGCTCCTGAACTCGAGTTCAGGAGCTACTTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-4272s1c1
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000169135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000627.2-4272s1c2
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000627
VALIDATED
LTBP1 MISSION shRNA shRNA Plasmid DNA
latent transforming growth factor beta binding protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-4124s21c1
Sequence:CCGGGATGACCTGTGTCGATGTAAACTCGAGTTTACATCGACACAGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-1701s21c1
Sequence:CCGGCCTGTTGAAGTAGCTCCTGAACTCGAGTTCAGGAGCTACTTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000627.2-4272s1c3
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-2718s21c1
Sequence:CCGGCCGGATGGATTTCAGCTAGATCTCGAGATCTAGCTGAAATCCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-4272s21c1
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-4568s21c1
Sequence:CCGGGGTGGAACAGTGCTGTTATTTCTCGAGAAATAACAGCACTGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-631s1c1
Sequence:CCGGCCGTCCAGATACATCAGGTTTCTCGAGAAACCTGATGTATCTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-4030s1c1
Sequence:CCGGGCATCCTCAATGGATGTGAAACTCGAGTTTCACATCCATTGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-2718s1c1
Sequence:CCGGCCGGATGGATTTCAGCTAGATCTCGAGATCTAGCTGAAATCCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-1701s1c1
Sequence:CCGGCCTGTTGAAGTAGCTCCTGAACTCGAGTTCAGGAGCTACTTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-4272s1c1
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000169135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000627.2-4272s1c2
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000627
VALIDATED
LTBP1 MISSION shRNA Lentiviral Transduction Particles
latent transforming growth factor beta binding protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-4124s21c1
Sequence:CCGGGATGACCTGTGTCGATGTAAACTCGAGTTTACATCGACACAGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-1701s21c1
Sequence:CCGGCCTGTTGAAGTAGCTCCTGAACTCGAGTTCAGGAGCTACTTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000627.2-4272s1c3
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-2718s21c1
Sequence:CCGGCCGGATGGATTTCAGCTAGATCTCGAGATCTAGCTGAAATCCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-4272s21c1
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000627.2-4568s21c1
Sequence:CCGGGGTGGAACAGTGCTGTTATTTCTCGAGAAATAACAGCACTGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-631s1c1
Sequence:CCGGCCGTCCAGATACATCAGGTTTCTCGAGAAACCTGATGTATCTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-4030s1c1
Sequence:CCGGGCATCCTCAATGGATGTGAAACTCGAGTTTCACATCCATTGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-2718s1c1
Sequence:CCGGCCGGATGGATTTCAGCTAGATCTCGAGATCTAGCTGAAATCCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-1701s1c1
Sequence:CCGGCCTGTTGAAGTAGCTCCTGAACTCGAGTTCAGGAGCTACTTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000627.2-4272s1c1
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000169135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000627.2-4272s1c2
Sequence:CCGGCCGTTGAATACCGCCTTGAATCTCGAGATTCAAGGCGGTATTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019919
VALIDATED
LTBP1 MISSION shRNA Bacterial Glycerol Stock
latent transforming growth factor beta binding protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-1596s1c1
Sequence:CCGGCCCTCCAAATTTCACAGGAAACTCGAGTTTCCTGTGAAATTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019919.2-3552s1c1
Sequence:CCGGCCATAGACACTGTCAAGATATCTCGAGATATCTTGACAGTGTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-4708s1c1
Sequence:CCGGCCTGTCAAATTACAGTGCTTTCTCGAGAAAGCACTGTAATTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-1771s1c1
Sequence:CCGGCCCAACATAGTCAATATCCATCTCGAGATGGATATTGACTATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-2125s1c1
Sequence:CCGGCCCAAGAAACAATCCTATCATCTCGAGATGATAGGATTGTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019919
VALIDATED
LTBP1 MISSION shRNA shRNA Plasmid DNA
latent transforming growth factor beta binding protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-1596s1c1
Sequence:CCGGCCCTCCAAATTTCACAGGAAACTCGAGTTTCCTGTGAAATTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019919.2-3552s1c1
Sequence:CCGGCCATAGACACTGTCAAGATATCTCGAGATATCTTGACAGTGTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-4708s1c1
Sequence:CCGGCCTGTCAAATTACAGTGCTTTCTCGAGAAAGCACTGTAATTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-1771s1c1
Sequence:CCGGCCCAACATAGTCAATATCCATCTCGAGATGGATATTGACTATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-2125s1c1
Sequence:CCGGCCCAAGAAACAATCCTATCATCTCGAGATGATAGGATTGTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019919
VALIDATED
LTBP1 MISSION shRNA Lentiviral Transduction Particles
latent transforming growth factor beta binding protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-1596s1c1
Sequence:CCGGCCCTCCAAATTTCACAGGAAACTCGAGTTTCCTGTGAAATTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019919.2-3552s1c1
Sequence:CCGGCCATAGACACTGTCAAGATATCTCGAGATATCTTGACAGTGTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-4708s1c1
Sequence:CCGGCCTGTCAAATTACAGTGCTTTCTCGAGAAAGCACTGTAATTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-1771s1c1
Sequence:CCGGCCCAACATAGTCAATATCCATCTCGAGATGGATATTGACTATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019919.2-2125s1c1
Sequence:CCGGCCCAAGAAACAATCCTATCATCTCGAGATGATAGGATTGTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks