EMAIL THIS PAGE TO A FRIEND

LUC7L

LUC7-like (S. cerevisiae)

Synonyms: LUC7-LIKE LUC7B1 Luc7 SR+89 hLuc7B1
UniProtKB ID: Q9NQ29, B8ZZ13, Q96S32, Q9NPH4
Gene ID:
Human(55692) Summary: The LUC7L gene may represent a mammalian heterochromatic gene, encoding a putative RNA-binding protein similar to the yeast Luc7p subunit of the U1 snRNP splicing complex that is normally required for 5-prime splice site selection (Tufarelli et al., 2001 [PubMed 11170747]
Mouse(66978) Luc7 homolog (S. cerevisiae)-like
Rat(360503) LUC7-like (S. cerevisiae)
Zebrafish(415206) LUC7-like (S. cerevisiae)
domestic cat(101089566) LUC7-like (S. cerevisiae)
cow(535131) LUC7-like (S. cerevisiae)
Horse(100065090) LUC7-like (S. cerevisiae)
dog(479898) LUC7-like (S. cerevisiae)
chicken(416654) LUC7-like (S. cerevisiae)
sheep(101109060) LUC7-like (S. cerevisiae)
naked mole-rat(101703753) LUC7-like (S. cerevisiae)
domestic guinea pig(100717695) LUC7-like (S. cerevisiae)
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018032 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018032 Rosetta Predictions human pricing
NM_201412 Rosetta Predictions human pricing
NM_001024269 Rosetta Predictions rat pricing
NM_025881 Rosetta Predictions mouse pricing
NM_028190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137031 predicted 442
2 SASI_Hs02_00351144 predicted 446
3 SASI_Hs01_00137032 predicted 383
4 SASI_Hs01_00137034 predicted 194
5 SASI_Hs01_00137035 predicted 456
6 SASI_Hs01_00137036 predicted 290
7 SASI_Hs01_00137038 predicted 401
8 SASI_Hs01_00137039 predicted 265
9 SASI_Hs02_00351145 predicted 402
10 SASI_Hs01_00137040 predicted 437
11 SASI_Hs01_00137033 predicted 377
12 SASI_Hs01_00137037 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227529 predicted 443
2 SASI_Hs02_00372945 predicted 449
3 SASI_Hs01_00227530 predicted 378
4 SASI_Hs01_00227532 predicted 201
5 SASI_Hs01_00227533 predicted 453
6 SASI_Hs01_00227534 predicted 293
7 SASI_Hs01_00227536 predicted 401
8 SASI_Hs01_00227537 predicted 271
9 SASI_Hs02_00372946 predicted 400
10 SASI_Hs01_00227538 predicted 438
11 SASI_Hs01_00227531 predicted 375
12 SASI_Hs01_00227535 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202445 predicted 445
2 SASI_Rn01_00106731 predicted 454
3 SASI_Rn01_00106732 predicted 1484
4 SASI_Rn01_00106733 predicted 1377
5 SASI_Rn01_00106734 predicted 1426
6 SASI_Rn01_00106736 predicted 438
7 SASI_Rn01_00106737 predicted 1347
8 SASI_Rn01_00106738 predicted 1364
9 SASI_Rn01_00106739 predicted 1212
10 SASI_Rn01_00106740 predicted 1340
11 SASI_Rn01_00106735 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074209 predicted 415
2 SASI_Mm01_00074210 predicted 568
3 SASI_Mm02_00329215 predicted 566
4 SASI_Mm01_00074211 predicted 620
5 SASI_Mm01_00074212 predicted 316
6 SASI_Mm02_00329216 predicted 208
7 SASI_Mm01_00074213 predicted 303
8 SASI_Mm02_00329217 predicted 386
9 SASI_Mm01_00074214 predicted 406
10 SASI_Mm01_00074215 predicted 554
11 SASI_Mm01_00074216 predicted 1149
12 SASI_Mm01_00074217 predicted 339
13 SASI_Mm01_00074218 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333485 predicted 408
2 SASI_Mm02_00333486 predicted 569
3 SASI_Mm02_00333487 predicted 559
4 SASI_Mm02_00333488 predicted 621
5 SASI_Mm02_00333489 predicted 309
6 SASI_Mm02_00333490 predicted 204
7 SASI_Mm02_00333491 predicted 303
8 SASI_Mm01_00120638 predicted 384
9 SASI_Mm01_00120639 predicted 401
10 SASI_Mm02_00333492 predicted 559
11 SASI_Mm01_00120636 predicted 295
12 SASI_Mm01_00120637 predicted 290
13 SASI_Mm01_00120640 predicted 275
14 SASI_Mm01_00120641 predicted 268
15 SASI_Mm01_00120642 predicted 356
16 SASI_Mm01_00120643 predicted 339
17 SASI_Mm01_00120644 predicted 342
18 SASI_Mm01_00120645 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018032
VALIDATED
LUC7L MISSION shRNA Bacterial Glycerol Stock
LUC7-like (S. cerevisiae)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.3-681s1c1
Sequence:CCGGCGAGGTCTGTTCAGCCTACCTCTCGAGAGGTAGGCTGAACAGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.3-1869s1c1
Sequence:CCGGGTGCTGTAAATAGTCTGATAACTCGAGTTATCAGACTATTTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.3-182s1c1
Sequence:CCGGCCAGACAGAGGGTCAAGTTTACTCGAGTAAACTTGACCCTCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018032.3-382s1c1
Sequence:CCGGGAGTCCTTTATTGCTGAATGTCTCGAGACATTCAGCAATAAAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018032.3-1476s1c1
Sequence:CCGGGCACTGTTTATGTTACAGTGACTCGAGTCACTGTAACATAAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018032.x-1411s1c1
Sequence:CCGGCGTAGTGTCATGTTCTGTGCACTCGAGTGCACAGAACATGACACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.x-425s1c1
Sequence:CCGGGAGGAAATCAGTGCGGAAGTTCTCGAGAACTTCCGCACTGATTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.x-371s1c1
Sequence:CCGGGCTGAATGTGATCGGAGAACTCTCGAGAGTTCTCCGATCACATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.x-294s1c1
Sequence:CCGGCAGATTATGAGATTGCAAGTACTCGAGTACTTGCAATCTCATAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018032.x-1045s1c1
Sequence:CCGGCCGAAGTGCGAAATACAAGTACTCGAGTACTTGTATTTCGCACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018032.3-394s21c1
Sequence:CCGGGCTGAATGTGATCGGAGAACTCTCGAGAGTTCTCCGATCACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018032.3-681s21c1
Sequence:CCGGCGAGGTCTGTTCAGCCTACCTCTCGAGAGGTAGGCTGAACAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018032.3-1491s21c1
Sequence:CCGGCAGTGAAGGCTCTCCTTATTACTCGAGTAATAAGGAGAGCCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018032.3-319s21c1
Sequence:CCGGGATTATGAGATTGCAAGTAAACTCGAGTTTACTTGCAATCTCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018032.3-448s21c1
Sequence:CCGGGAGGAAATCAGTGCGGAAGTTCTCGAGAACTTCCGCACTGATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018032
VALIDATED
LUC7L MISSION shRNA shRNA Plasmid DNA
LUC7-like (S. cerevisiae)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.3-681s1c1
Sequence:CCGGCGAGGTCTGTTCAGCCTACCTCTCGAGAGGTAGGCTGAACAGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.3-1869s1c1
Sequence:CCGGGTGCTGTAAATAGTCTGATAACTCGAGTTATCAGACTATTTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.3-182s1c1
Sequence:CCGGCCAGACAGAGGGTCAAGTTTACTCGAGTAAACTTGACCCTCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018032.3-382s1c1
Sequence:CCGGGAGTCCTTTATTGCTGAATGTCTCGAGACATTCAGCAATAAAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018032.3-1476s1c1
Sequence:CCGGGCACTGTTTATGTTACAGTGACTCGAGTCACTGTAACATAAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018032.x-1411s1c1
Sequence:CCGGCGTAGTGTCATGTTCTGTGCACTCGAGTGCACAGAACATGACACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.x-425s1c1
Sequence:CCGGGAGGAAATCAGTGCGGAAGTTCTCGAGAACTTCCGCACTGATTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.x-371s1c1
Sequence:CCGGGCTGAATGTGATCGGAGAACTCTCGAGAGTTCTCCGATCACATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.x-294s1c1
Sequence:CCGGCAGATTATGAGATTGCAAGTACTCGAGTACTTGCAATCTCATAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018032.x-1045s1c1
Sequence:CCGGCCGAAGTGCGAAATACAAGTACTCGAGTACTTGTATTTCGCACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018032.3-394s21c1
Sequence:CCGGGCTGAATGTGATCGGAGAACTCTCGAGAGTTCTCCGATCACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018032.3-681s21c1
Sequence:CCGGCGAGGTCTGTTCAGCCTACCTCTCGAGAGGTAGGCTGAACAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018032.3-1491s21c1
Sequence:CCGGCAGTGAAGGCTCTCCTTATTACTCGAGTAATAAGGAGAGCCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018032.3-319s21c1
Sequence:CCGGGATTATGAGATTGCAAGTAAACTCGAGTTTACTTGCAATCTCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018032.3-448s21c1
Sequence:CCGGGAGGAAATCAGTGCGGAAGTTCTCGAGAACTTCCGCACTGATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018032
VALIDATED
LUC7L MISSION shRNA Lentiviral Transduction Particles
LUC7-like (S. cerevisiae)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.3-681s1c1
Sequence:CCGGCGAGGTCTGTTCAGCCTACCTCTCGAGAGGTAGGCTGAACAGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.3-1869s1c1
Sequence:CCGGGTGCTGTAAATAGTCTGATAACTCGAGTTATCAGACTATTTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.3-182s1c1
Sequence:CCGGCCAGACAGAGGGTCAAGTTTACTCGAGTAAACTTGACCCTCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018032.3-382s1c1
Sequence:CCGGGAGTCCTTTATTGCTGAATGTCTCGAGACATTCAGCAATAAAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018032.3-1476s1c1
Sequence:CCGGGCACTGTTTATGTTACAGTGACTCGAGTCACTGTAACATAAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018032.x-1411s1c1
Sequence:CCGGCGTAGTGTCATGTTCTGTGCACTCGAGTGCACAGAACATGACACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.x-425s1c1
Sequence:CCGGGAGGAAATCAGTGCGGAAGTTCTCGAGAACTTCCGCACTGATTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.x-371s1c1
Sequence:CCGGGCTGAATGTGATCGGAGAACTCTCGAGAGTTCTCCGATCACATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018032.x-294s1c1
Sequence:CCGGCAGATTATGAGATTGCAAGTACTCGAGTACTTGCAATCTCATAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018032.x-1045s1c1
Sequence:CCGGCCGAAGTGCGAAATACAAGTACTCGAGTACTTGTATTTCGCACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018032.3-394s21c1
Sequence:CCGGGCTGAATGTGATCGGAGAACTCTCGAGAGTTCTCCGATCACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018032.3-681s21c1
Sequence:CCGGCGAGGTCTGTTCAGCCTACCTCTCGAGAGGTAGGCTGAACAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018032.3-1491s21c1
Sequence:CCGGCAGTGAAGGCTCTCCTTATTACTCGAGTAATAAGGAGAGCCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018032.3-319s21c1
Sequence:CCGGGATTATGAGATTGCAAGTAAACTCGAGTTTACTTGCAATCTCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018032.3-448s21c1
Sequence:CCGGGAGGAAATCAGTGCGGAAGTTCTCGAGAACTTCCGCACTGATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025881
VALIDATED
LUC7L MISSION shRNA Bacterial Glycerol Stock
LUC7-like (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025881.1-1301s1c1
Sequence:CCGGGCTGGGCTTTACCTACTTTAACTCGAGTTAAAGTAGGTAAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025881.1-407s1c1
Sequence:CCGGCAGGAGGAAATCAGTGCAGAACTCGAGTTCTGCACTGATTTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025881.1-228s1c1
Sequence:CCGGCGCGCATGGATTTAGGAGAATCTCGAGATTCTCCTAAATCCATGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025881.1-149s1c1
Sequence:CCGGCAGAGGGTCAAGTTTACAGATCTCGAGATCTGTAAACTTGACCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-455s21c1
Sequence:CCGGCAGGAGGAAATCAGTGCAGAACTCGAGTTCTGCACTGATTTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025881.2-1459s21c1
Sequence:CCGGGGCATTCACTTTGTAACTTAACTCGAGTTAAGTTACAAAGTGAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-320s21c1
Sequence:CCGGCTTCGAGCAGATTATGAAATTCTCGAGAATTTCATAATCTGCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-998s21c1
Sequence:CCGGTCCAGATCCCGAGATAGATACCTCGAGGTATCTATCTCGGGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-679s21c1
Sequence:CCGGACTCCGTGTTTGCGAGGTTTGCTCGAGCAAACCTCGCAAACACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025881
VALIDATED
LUC7L MISSION shRNA shRNA Plasmid DNA
LUC7-like (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025881.1-1301s1c1
Sequence:CCGGGCTGGGCTTTACCTACTTTAACTCGAGTTAAAGTAGGTAAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025881.1-407s1c1
Sequence:CCGGCAGGAGGAAATCAGTGCAGAACTCGAGTTCTGCACTGATTTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025881.1-228s1c1
Sequence:CCGGCGCGCATGGATTTAGGAGAATCTCGAGATTCTCCTAAATCCATGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025881.1-149s1c1
Sequence:CCGGCAGAGGGTCAAGTTTACAGATCTCGAGATCTGTAAACTTGACCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-455s21c1
Sequence:CCGGCAGGAGGAAATCAGTGCAGAACTCGAGTTCTGCACTGATTTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025881.2-1459s21c1
Sequence:CCGGGGCATTCACTTTGTAACTTAACTCGAGTTAAGTTACAAAGTGAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-320s21c1
Sequence:CCGGCTTCGAGCAGATTATGAAATTCTCGAGAATTTCATAATCTGCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-998s21c1
Sequence:CCGGTCCAGATCCCGAGATAGATACCTCGAGGTATCTATCTCGGGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-679s21c1
Sequence:CCGGACTCCGTGTTTGCGAGGTTTGCTCGAGCAAACCTCGCAAACACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025881
VALIDATED
LUC7L MISSION shRNA Lentiviral Transduction Particles
LUC7-like (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025881.1-1301s1c1
Sequence:CCGGGCTGGGCTTTACCTACTTTAACTCGAGTTAAAGTAGGTAAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025881.1-407s1c1
Sequence:CCGGCAGGAGGAAATCAGTGCAGAACTCGAGTTCTGCACTGATTTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025881.1-228s1c1
Sequence:CCGGCGCGCATGGATTTAGGAGAATCTCGAGATTCTCCTAAATCCATGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025881.1-149s1c1
Sequence:CCGGCAGAGGGTCAAGTTTACAGATCTCGAGATCTGTAAACTTGACCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-455s21c1
Sequence:CCGGCAGGAGGAAATCAGTGCAGAACTCGAGTTCTGCACTGATTTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025881.2-1459s21c1
Sequence:CCGGGGCATTCACTTTGTAACTTAACTCGAGTTAAGTTACAAAGTGAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-320s21c1
Sequence:CCGGCTTCGAGCAGATTATGAAATTCTCGAGAATTTCATAATCTGCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-998s21c1
Sequence:CCGGTCCAGATCCCGAGATAGATACCTCGAGGTATCTATCTCGGGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025881.2-679s21c1
Sequence:CCGGACTCCGTGTTTGCGAGGTTTGCTCGAGCAAACCTCGCAAACACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks