EMAIL THIS PAGE TO A FRIEND

LUZP4

leucine zipper protein 4

Synonyms: CT-28 CT-8 CT28 HOM-TES-85
UniProtKB ID: Q9P127
Gene ID:
Human(51213) Summary: This gene encodes a protein which contains two sets of heptad repeats in the N-terminus; the C-terminal most repeats form a leucine zipper domain. The presence of a leucine zipper domain suggests the protein may have DNA-binding activity and the protein has been shown to localize with a spliceosome protein (PMID: 12032826). [provided by RefSeq, Aug 2011]
Mouse(434865) leucine zipper protein 4
cow(101908133) leucine zipper protein 4
naked mole-rat(101696905) leucine zipper protein 4
domestic guinea pig(100732827) leucine zipper protein 4
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016383 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001114383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001114383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001114383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000501 MISSION® esiRNA esiRNA targeting human LUZP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016383 Rosetta Predictions human pricing
NM_001114383 Rosetta Predictions mouse pricing
XM_486789 Rosetta Predictions mouse pricing
XM_888090 Rosetta Predictions mouse pricing
XM_897881 Rosetta Predictions mouse pricing
XM_897890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122140 predicted 905
2 SASI_Hs01_00122141 predicted 934
3 SASI_Hs01_00122142 predicted 641
4 SASI_Hs01_00122143 predicted 677
5 SASI_Hs01_00122144 predicted 611
6 SASI_Hs01_00122145 predicted 548
7 SASI_Hs02_00349380 predicted 779
8 SASI_Hs01_00122146 predicted 451
9 SASI_Hs01_00122147 predicted 532
10 SASI_Hs01_00122148 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308600 predicted 1079
2 SASI_Mm02_00308601 predicted 659
3 SASI_Mm02_00308602 predicted 804
4 SASI_Mm02_00308603 predicted 428
5 SASI_Mm02_00308604 predicted 1245
6 SASI_Mm02_00308605 predicted 1041
7 SASI_Mm02_00308606 predicted 291
8 SASI_Mm02_00308607 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280128 predicted 665
2 SASI_Mm01_00280129 predicted 803
3 SASI_Mm01_00280130 predicted 335
4 SASI_Mm01_00280131 predicted 435
5 SASI_Mm01_00280132 predicted 525
6 SASI_Mm01_00280133 predicted 295
7 SASI_Mm01_00280134 predicted 511
8 SASI_Mm01_00280135 predicted 461
9 SASI_Mm01_00280136 predicted 686
10 SASI_Mm01_00280137 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241457 predicted 662
2 SASI_Mm01_00241458 predicted 805
3 SASI_Mm01_00241459 predicted 323
4 SASI_Mm01_00241460 predicted 426
5 SASI_Mm01_00241461 predicted 517
6 SASI_Mm01_00241462 predicted 297
7 SASI_Mm01_00241463 predicted 497
8 SASI_Mm01_00241464 predicted 454
9 SASI_Mm01_00241465 predicted 671
10 SASI_Mm01_00241466 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280350 predicted 661
2 SASI_Mm01_00280351 predicted 803
3 SASI_Mm01_00280352 predicted 327
4 SASI_Mm01_00280353 predicted 429
5 SASI_Mm01_00280354 predicted 517
6 SASI_Mm01_00280355 predicted 293
7 SASI_Mm01_00280356 predicted 496
8 SASI_Mm01_00280357 predicted 447
9 SASI_Mm01_00280358 predicted 676
10 SASI_Mm01_00280359 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230184 predicted 635
2 SASI_Mm01_00230185 predicted 778
3 SASI_Mm01_00230186 predicted 306
4 SASI_Mm01_00230187 predicted 408
5 SASI_Mm01_00230188 predicted 492
6 SASI_Mm01_00230189 predicted 265
7 SASI_Mm01_00230190 predicted 476
8 SASI_Mm01_00230191 predicted 429
9 SASI_Mm01_00230192 predicted 648
10 SASI_Mm01_00230193 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016383
LUZP4 MISSION shRNA Bacterial Glycerol Stock
leucine zipper protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016383.2-1141s1c1
Sequence:CCGGCCCATTAAGTTGTTCCCGGTACTCGAGTACCGGGAACAACTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-765s1c1
Sequence:CCGGGCCACTCAGAAAGATCTCATACTCGAGTATGAGATCTTTCTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-410s1c1
Sequence:CCGGCCAGCATCAATCAGAAGGAAACTCGAGTTTCCTTCTGATTGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-332s1c1
Sequence:CCGGGCCTTTAATTGAGCAGGAGAACTCGAGTTCTCCTGCTCAATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-181s1c1
Sequence:CCGGCGCCTTCAAGACAGCAATCAACTCGAGTTGATTGCTGTCTTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016383.3-334s21c1
Sequence:CCGGGTCTGGACAACACCCTTTAAACTCGAGTTTAAAGGGTGTTGTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016383.3-1065s21c1
Sequence:CCGGTATTGGGACAAAGACATAAATCTCGAGATTTATGTCTTTGTCCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016383.3-118s21c1
Sequence:CCGGGTCTCTAGACGACATTATAATCTCGAGATTATAATGTCGTCTAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016383
LUZP4 MISSION shRNA shRNA Plasmid DNA
leucine zipper protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016383.2-1141s1c1
Sequence:CCGGCCCATTAAGTTGTTCCCGGTACTCGAGTACCGGGAACAACTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-765s1c1
Sequence:CCGGGCCACTCAGAAAGATCTCATACTCGAGTATGAGATCTTTCTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-410s1c1
Sequence:CCGGCCAGCATCAATCAGAAGGAAACTCGAGTTTCCTTCTGATTGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-332s1c1
Sequence:CCGGGCCTTTAATTGAGCAGGAGAACTCGAGTTCTCCTGCTCAATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-181s1c1
Sequence:CCGGCGCCTTCAAGACAGCAATCAACTCGAGTTGATTGCTGTCTTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016383.3-334s21c1
Sequence:CCGGGTCTGGACAACACCCTTTAAACTCGAGTTTAAAGGGTGTTGTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016383.3-1065s21c1
Sequence:CCGGTATTGGGACAAAGACATAAATCTCGAGATTTATGTCTTTGTCCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016383.3-118s21c1
Sequence:CCGGGTCTCTAGACGACATTATAATCTCGAGATTATAATGTCGTCTAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016383
LUZP4 MISSION shRNA Lentiviral Transduction Particles
leucine zipper protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016383.2-1141s1c1
Sequence:CCGGCCCATTAAGTTGTTCCCGGTACTCGAGTACCGGGAACAACTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-765s1c1
Sequence:CCGGGCCACTCAGAAAGATCTCATACTCGAGTATGAGATCTTTCTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-410s1c1
Sequence:CCGGCCAGCATCAATCAGAAGGAAACTCGAGTTTCCTTCTGATTGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-332s1c1
Sequence:CCGGGCCTTTAATTGAGCAGGAGAACTCGAGTTCTCCTGCTCAATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016383.2-181s1c1
Sequence:CCGGCGCCTTCAAGACAGCAATCAACTCGAGTTGATTGCTGTCTTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016383.3-334s21c1
Sequence:CCGGGTCTGGACAACACCCTTTAAACTCGAGTTTAAAGGGTGTTGTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016383.3-1065s21c1
Sequence:CCGGTATTGGGACAAAGACATAAATCTCGAGATTTATGTCTTTGTCCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016383.3-118s21c1
Sequence:CCGGGTCTCTAGACGACATTATAATCTCGAGATTATAATGTCGTCTAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114383
VALIDATED
LUZP4 MISSION shRNA Bacterial Glycerol Stock
leucine zipper protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1295s21c1
Sequence:CCGGGTACAGGAACATCGAAGAAATCTCGAGATTTCTTCGATGTTCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1109s21c1
Sequence:CCGGCGGTCACGGAGAGATCGTTATCTCGAGATAACGATCTCTCCGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1396s21c1
Sequence:CCGGCTGTCGCTCCATGCTAGATACCTCGAGGTATCTAGCATGGAGCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1061s21c1
Sequence:CCGGCAGTCACAGAGAGGTCATAATCTCGAGATTATGACCTCTCTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1499s21c1
Sequence:CCGGGGCGTTGGCAGCTAGCTAATTCTCGAGAATTAGCTAGCTGCCAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114383
VALIDATED
LUZP4 MISSION shRNA shRNA Plasmid DNA
leucine zipper protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1295s21c1
Sequence:CCGGGTACAGGAACATCGAAGAAATCTCGAGATTTCTTCGATGTTCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1109s21c1
Sequence:CCGGCGGTCACGGAGAGATCGTTATCTCGAGATAACGATCTCTCCGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1396s21c1
Sequence:CCGGCTGTCGCTCCATGCTAGATACCTCGAGGTATCTAGCATGGAGCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1061s21c1
Sequence:CCGGCAGTCACAGAGAGGTCATAATCTCGAGATTATGACCTCTCTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1499s21c1
Sequence:CCGGGGCGTTGGCAGCTAGCTAATTCTCGAGAATTAGCTAGCTGCCAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114383
VALIDATED
LUZP4 MISSION shRNA Lentiviral Transduction Particles
leucine zipper protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1295s21c1
Sequence:CCGGGTACAGGAACATCGAAGAAATCTCGAGATTTCTTCGATGTTCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1109s21c1
Sequence:CCGGCGGTCACGGAGAGATCGTTATCTCGAGATAACGATCTCTCCGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1396s21c1
Sequence:CCGGCTGTCGCTCCATGCTAGATACCTCGAGGTATCTAGCATGGAGCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1061s21c1
Sequence:CCGGCAGTCACAGAGAGGTCATAATCTCGAGATTATGACCTCTCTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001114383.1-1499s21c1
Sequence:CCGGGGCGTTGGCAGCTAGCTAATTCTCGAGAATTAGCTAGCTGCCAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks