EMAIL THIS PAGE TO A FRIEND

LYRM2

LYR motif containing 2

Synonyms: DJ122O8.2
UniProtKB ID: Q9NU23, B2R4U2, E1P517
Gene ID:
Mouse(108755) LYR motif containing 2
Rat(690354) LYR motif containing 2
Zebrafish(569076) LYR motif containing 2
cow(615821) LYR motif containing 2
dog(481920) LYR motif containing 2
domestic cat(101094927) LYR motif containing 2
chicken(421812) LYR motif containing 2
naked mole-rat(101721070) LYR motif containing 2
domestic guinea pig(100714467) LYR motif containing 2
sheep(101109621) LYR motif containing 2
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020466 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020466 Rosetta Predictions human pricing
NM_001126096 Rosetta Predictions rat pricing
NM_175364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353524 predicted 375
2 SASI_Hs02_00353525 predicted 143
3 SASI_Hs02_00353526 predicted 85
4 SASI_Hs02_00353527 predicted 4095
5 SASI_Hs02_00353528 predicted 3764
6 SASI_Hs02_00353529 predicted 2052
7 SASI_Hs02_00353530 predicted 4548
8 SASI_Hs02_00353531 predicted 1518
9 SASI_Hs02_00353532 predicted 3782
10 SASI_Hs02_00353533 predicted 4783
11 SASI_Hs01_00107020 predicted 228
12 SASI_Hs01_00107021 predicted 211
13 SASI_Hs01_00107022 predicted 236
14 SASI_Hs01_00107023 predicted 223
15 SASI_Hs01_00107024 predicted 251
16 SASI_Hs01_00107025 predicted 214
17 SASI_Hs01_00107026 predicted 218
18 SASI_Hs01_00107027 predicted 224
19 SASI_Hs01_00107028 predicted 234
20 SASI_Hs01_00107029 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252973 predicted 284
2 SASI_Rn02_00252974 predicted 737
3 SASI_Rn02_00252975 predicted 227
4 SASI_Rn02_00252976 predicted 505
5 SASI_Rn02_00252977 predicted 254
6 SASI_Rn02_00252978 predicted 770
7 SASI_Rn02_00252979 predicted 229
8 SASI_Rn02_00252980 predicted 372
9 SASI_Rn02_00252981 predicted 507
10 SASI_Rn02_00252982 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100334 predicted 236
2 SASI_Mm01_00100335 predicted 360
3 SASI_Mm01_00100336 predicted 371
4 SASI_Mm01_00100338 predicted 263
5 SASI_Mm01_00100340 predicted 135
6 SASI_Mm01_00100341 predicted 509
7 SASI_Mm01_00100342 predicted 781
8 SASI_Mm01_00100343 predicted 91
9 SASI_Mm02_00346166 predicted 442
10 SASI_Mm02_00346167 predicted 714
11 SASI_Mm01_00100337 predicted 330
12 SASI_Mm01_00100339 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175364
VALIDATED
LYRM2 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175364.2-72s1c1
Sequence:CCGGGTTCATGAGAAGGCAGCAAGTCTCGAGACTTGCTGCCTTCTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175364.2-980s1c1
Sequence:CCGGCGCTAGATCTTGCTTGAATAACTCGAGTTATTCAAGCAAGATCTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175364.2-1077s1c1
Sequence:CCGGCGCGGAGCTTTAGTGGAAATACTCGAGTATTTCCACTAAAGCTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-227s21c1
Sequence:CCGGGATGATAACCCAAGGCAATATCTCGAGATATTGCCTTGGGTTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-125s21c1
Sequence:CCGGTAGGCAAGTTCCAAGTGATTCCTCGAGGAATCACTTGGAACTTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175364.3-834s21c1
Sequence:CCGGGGGTCTAGTATTAGGTATTTACTCGAGTAAATACCTAATACTAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-167s21c1
Sequence:CCGGTTGGGCCAGGGAAGAATTTAACTCGAGTTAAATTCTTCCCTGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-201s21c1
Sequence:CCGGGCCACAGAAGAGGATACAATCCTCGAGGATTGTATCCTCTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175364
VALIDATED
LYRM2 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175364.2-72s1c1
Sequence:CCGGGTTCATGAGAAGGCAGCAAGTCTCGAGACTTGCTGCCTTCTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175364.2-980s1c1
Sequence:CCGGCGCTAGATCTTGCTTGAATAACTCGAGTTATTCAAGCAAGATCTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175364.2-1077s1c1
Sequence:CCGGCGCGGAGCTTTAGTGGAAATACTCGAGTATTTCCACTAAAGCTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-227s21c1
Sequence:CCGGGATGATAACCCAAGGCAATATCTCGAGATATTGCCTTGGGTTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-125s21c1
Sequence:CCGGTAGGCAAGTTCCAAGTGATTCCTCGAGGAATCACTTGGAACTTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175364.3-834s21c1
Sequence:CCGGGGGTCTAGTATTAGGTATTTACTCGAGTAAATACCTAATACTAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-167s21c1
Sequence:CCGGTTGGGCCAGGGAAGAATTTAACTCGAGTTAAATTCTTCCCTGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-201s21c1
Sequence:CCGGGCCACAGAAGAGGATACAATCCTCGAGGATTGTATCCTCTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175364
VALIDATED
LYRM2 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175364.2-72s1c1
Sequence:CCGGGTTCATGAGAAGGCAGCAAGTCTCGAGACTTGCTGCCTTCTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175364.2-980s1c1
Sequence:CCGGCGCTAGATCTTGCTTGAATAACTCGAGTTATTCAAGCAAGATCTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175364.2-1077s1c1
Sequence:CCGGCGCGGAGCTTTAGTGGAAATACTCGAGTATTTCCACTAAAGCTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-227s21c1
Sequence:CCGGGATGATAACCCAAGGCAATATCTCGAGATATTGCCTTGGGTTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-125s21c1
Sequence:CCGGTAGGCAAGTTCCAAGTGATTCCTCGAGGAATCACTTGGAACTTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175364.3-834s21c1
Sequence:CCGGGGGTCTAGTATTAGGTATTTACTCGAGTAAATACCTAATACTAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-167s21c1
Sequence:CCGGTTGGGCCAGGGAAGAATTTAACTCGAGTTAAATTCTTCCCTGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175364.3-201s21c1
Sequence:CCGGGCCACAGAAGAGGATACAATCCTCGAGGATTGTATCCTCTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020466
VALIDATED
LYRM2 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-154s1c1
Sequence:CCGGGATCGCAAATACCTGAAAGATCTCGAGATCTTTCAGGTATTTGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020466.3-233s1c1
Sequence:CCGGTGATGATTACTCAAGGCAATACTCGAGTATTGCCTTGAGTAATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-90s1c1
Sequence:CCGGGCAACAAGTTCTTCTCCTCTACTCGAGTAGAGGAGAAGAACTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-213s1c1
Sequence:CCGGCGAAGAGGATACAATCCGGATCTCGAGATCCGGATTGTATCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-64s1c1
Sequence:CCGGCTAACGTTAAAGCAGTTCGTACTCGAGTACGAACTGCTTTAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-240s21c1
Sequence:CCGGGATGATTACTCAAGGCAATATCTCGAGATATTGCCTTGAGTAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-73s21c1
Sequence:GTACCGGACGTTAAAGCAGTTCGTAAGACTCGAGTCTTACGAACTGCTTTAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-917s21c1
Sequence:CCGGTCACTAGAATGGCTGTAATTACTCGAGTAATTACAGCCATTCTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020466.4-214s21c1
Sequence:CCGGGCCACCGAAGAGGATACAATCCTCGAGGATTGTATCCTCTTCGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-149s21c1
Sequence:CCGGCAAATGATTCTGATCGCAAATCTCGAGATTTGCGATCAGAATCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020466
VALIDATED
LYRM2 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-154s1c1
Sequence:CCGGGATCGCAAATACCTGAAAGATCTCGAGATCTTTCAGGTATTTGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020466.3-233s1c1
Sequence:CCGGTGATGATTACTCAAGGCAATACTCGAGTATTGCCTTGAGTAATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-90s1c1
Sequence:CCGGGCAACAAGTTCTTCTCCTCTACTCGAGTAGAGGAGAAGAACTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-213s1c1
Sequence:CCGGCGAAGAGGATACAATCCGGATCTCGAGATCCGGATTGTATCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-64s1c1
Sequence:CCGGCTAACGTTAAAGCAGTTCGTACTCGAGTACGAACTGCTTTAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-240s21c1
Sequence:CCGGGATGATTACTCAAGGCAATATCTCGAGATATTGCCTTGAGTAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-73s21c1
Sequence:GTACCGGACGTTAAAGCAGTTCGTAAGACTCGAGTCTTACGAACTGCTTTAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-917s21c1
Sequence:CCGGTCACTAGAATGGCTGTAATTACTCGAGTAATTACAGCCATTCTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020466.4-214s21c1
Sequence:CCGGGCCACCGAAGAGGATACAATCCTCGAGGATTGTATCCTCTTCGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-149s21c1
Sequence:CCGGCAAATGATTCTGATCGCAAATCTCGAGATTTGCGATCAGAATCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020466
VALIDATED
LYRM2 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-154s1c1
Sequence:CCGGGATCGCAAATACCTGAAAGATCTCGAGATCTTTCAGGTATTTGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020466.3-233s1c1
Sequence:CCGGTGATGATTACTCAAGGCAATACTCGAGTATTGCCTTGAGTAATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-90s1c1
Sequence:CCGGGCAACAAGTTCTTCTCCTCTACTCGAGTAGAGGAGAAGAACTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-213s1c1
Sequence:CCGGCGAAGAGGATACAATCCGGATCTCGAGATCCGGATTGTATCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020466.3-64s1c1
Sequence:CCGGCTAACGTTAAAGCAGTTCGTACTCGAGTACGAACTGCTTTAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-240s21c1
Sequence:CCGGGATGATTACTCAAGGCAATATCTCGAGATATTGCCTTGAGTAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-73s21c1
Sequence:GTACCGGACGTTAAAGCAGTTCGTAAGACTCGAGTCTTACGAACTGCTTTAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-917s21c1
Sequence:CCGGTCACTAGAATGGCTGTAATTACTCGAGTAATTACAGCCATTCTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020466.4-214s21c1
Sequence:CCGGGCCACCGAAGAGGATACAATCCTCGAGGATTGTATCCTCTTCGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020466.4-149s21c1
Sequence:CCGGCAAATGATTCTGATCGCAAATCTCGAGATTTGCGATCAGAATCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks