EMAIL THIS PAGE TO A FRIEND

LYZ

lysozyme

Synonyms: LZM
UniProtKB ID: P61626, P00695, Q13170, Q9UCF8
Gene ID:
Human(4069) Summary: This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]
sheep(100049062) lysozyme
dog(474442) lysozyme
cow(777776) lysozyme
chicken(396218) lysozyme (renal amyloidosis)
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000239 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028121 MISSION® esiRNA esiRNA human LYZ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000239 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176800 predicted 483
2 SASI_Hs01_00176801 predicted 321
3 SASI_Hs01_00176802 predicted 538
4 SASI_Hs02_00302152 predicted 460
5 SASI_Hs01_00176803 predicted 387
6 SASI_Hs01_00176805 predicted 489
7 SASI_Hs02_00302153 predicted 194
8 SASI_Hs02_00302154 predicted 547
9 SASI_Hs01_00176808 predicted 432
10 SASI_Hs02_00302155 predicted 331
11 SASI_Hs01_00176804 predicted 374
12 SASI_Hs01_00176806 predicted 228
13 SASI_Hs01_00176807 predicted 243
14 SASI_Hs01_00176809 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000239
LYZ MISSION shRNA Bacterial Glycerol Stock
lysozyme
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000239.1-1036s1c1
Sequence:CCGGCCGGCCACATTCAGTTCTTATCTCGAGATAAGAACTGAATGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-228s1c1
Sequence:CCGGGAAGCACTGATTATGGGATATCTCGAGATATCCCATAATCAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-321s1c1
Sequence:CCGGGCAGTGCTTTGCTGCAAGATACTCGAGTATCTTGCAGCAAAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-150s1c1
Sequence:CCGGGCCTAGCAAACTGGATGTGTTCTCGAGAACACATCCAGTTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-227s1c1
Sequence:CCGGAGAAGCACTGATTATGGGATACTCGAGTATCCCATAATCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000239.2-327s21c1
Sequence:CCGGCAGTTAATGCCTGTCATTTATCTCGAGATAAATGACAGGCATTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000239.2-566s21c1
Sequence:CCGGGAAAGGTCACACTACCATTATCTCGAGATAATGGTAGTGTGACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000239.2-678s21c1
Sequence:CCGGTACATTAAGCCTACAACATTTCTCGAGAAATGTTGTAGGCTTAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000239
LYZ MISSION shRNA shRNA Plasmid DNA
lysozyme
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000239.1-1036s1c1
Sequence:CCGGCCGGCCACATTCAGTTCTTATCTCGAGATAAGAACTGAATGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-228s1c1
Sequence:CCGGGAAGCACTGATTATGGGATATCTCGAGATATCCCATAATCAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-321s1c1
Sequence:CCGGGCAGTGCTTTGCTGCAAGATACTCGAGTATCTTGCAGCAAAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-150s1c1
Sequence:CCGGGCCTAGCAAACTGGATGTGTTCTCGAGAACACATCCAGTTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-227s1c1
Sequence:CCGGAGAAGCACTGATTATGGGATACTCGAGTATCCCATAATCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000239.2-327s21c1
Sequence:CCGGCAGTTAATGCCTGTCATTTATCTCGAGATAAATGACAGGCATTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000239.2-566s21c1
Sequence:CCGGGAAAGGTCACACTACCATTATCTCGAGATAATGGTAGTGTGACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000239.2-678s21c1
Sequence:CCGGTACATTAAGCCTACAACATTTCTCGAGAAATGTTGTAGGCTTAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000239
LYZ MISSION shRNA Lentiviral Transduction Particles
lysozyme
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000239.1-1036s1c1
Sequence:CCGGCCGGCCACATTCAGTTCTTATCTCGAGATAAGAACTGAATGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-228s1c1
Sequence:CCGGGAAGCACTGATTATGGGATATCTCGAGATATCCCATAATCAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-321s1c1
Sequence:CCGGGCAGTGCTTTGCTGCAAGATACTCGAGTATCTTGCAGCAAAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-150s1c1
Sequence:CCGGGCCTAGCAAACTGGATGTGTTCTCGAGAACACATCCAGTTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000239.1-227s1c1
Sequence:CCGGAGAAGCACTGATTATGGGATACTCGAGTATCCCATAATCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000239.2-327s21c1
Sequence:CCGGCAGTTAATGCCTGTCATTTATCTCGAGATAAATGACAGGCATTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000239.2-566s21c1
Sequence:CCGGGAAAGGTCACACTACCATTATCTCGAGATAATGGTAGTGTGACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000239.2-678s21c1
Sequence:CCGGTACATTAAGCCTACAACATTTCTCGAGAAATGTTGTAGGCTTAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks