EMAIL THIS PAGE TO A FRIEND

LYZL1

lysozyme-like 1

Synonyms: KAAG648 LYC2 PRO1278 bA534G20.1
UniProtKB ID: Q6UWQ5, Q5T921, Q8WW16
Gene ID:
Mouse(67328) lysozyme-like 1
Rat(364745) lysozyme-like 1
dog(487083) lysozyme-like 1
domestic cat(101090367) lysozyme-like 1
cow(512087) lysozyme-like 1
sheep(101117350) lysozyme-like 1
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032517 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108871 MISSION® esiRNA esiRNA human LYZL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032517 Rosetta Predictions human pricing
NM_001108882 Rosetta Predictions rat pricing
NM_026092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030189 predicted 201
2 SASI_Hs01_00030190 predicted 330
3 SASI_Hs01_00030192 predicted 255
4 SASI_Hs01_00030193 predicted 575
5 SASI_Hs01_00030194 predicted 230
6 SASI_Hs01_00030196 predicted 345
7 SASI_Hs01_00030197 predicted 517
8 SASI_Hs01_00030198 predicted 453
9 SASI_Hs02_00360011 predicted 489
10 SASI_Hs02_00360012 predicted 392
11 SASI_Hs01_00030191 predicted 545
12 SASI_Hs01_00030195 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243015 predicted 202
2 SASI_Rn02_00243016 predicted 462
3 SASI_Rn02_00243017 predicted 605
4 SASI_Rn02_00243018 predicted 613
5 SASI_Rn02_00243019 predicted 465
6 SASI_Rn02_00243020 predicted 284
7 SASI_Rn02_00243021 predicted 204
8 SASI_Rn02_00243022 predicted 298
9 SASI_Rn02_00243023 predicted 494
10 SASI_Rn02_00243024 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101536 predicted 523
2 SASI_Mm01_00101538 predicted 494
3 SASI_Mm01_00101539 predicted 561
4 SASI_Mm01_00101540 predicted 206
5 SASI_Mm01_00101541 predicted 618
6 SASI_Mm01_00101542 predicted 286
7 SASI_Mm02_00329665 predicted 453
8 SASI_Mm01_00101543 predicted 319
9 SASI_Mm01_00101544 predicted 496
10 SASI_Mm02_00329666 predicted 622
11 SASI_Mm01_00101537 predicted 397
12 SASI_Mm01_00101545 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032517
LYZL1 MISSION shRNA Bacterial Glycerol Stock
lysozyme-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032517.4-350s21c1
Sequence:CCGGATTATGAGAGCGGCTACAACACTCGAGTGTTGTAGCCGCTCTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032517.4-392s21c1
Sequence:CCGGATGACGGCAGCATCGACTATGCTCGAGCATAGTCGATGCTGCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032517.4-624s21c1
Sequence:CCGGAGGCTGTGAGGTTTCCTAAACCTCGAGGTTTAGGAAACCTCACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-290s1c1
Sequence:CCGGCCTTGGAAACTGGATCTGCATCTCGAGATGCAGATCCAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-486s1c1
Sequence:CCGGGCAATTATCTGTGCCAGGAAACTCGAGTTTCCTGGCACAGATAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-522s1c1
Sequence:CCGGCAAGGAATGAACTATTGGCAACTCGAGTTGCCAATAGTTCATTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-171s1c1
Sequence:CCGGGCGGGCATTCTGACCCTCATTCTCGAGAATGAGGGTCAGAATGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-416s1c1
Sequence:CCGGCGGAAAGCTGAAGGAGAACAACTCGAGTTGTTCTCCTTCAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032517
LYZL1 MISSION shRNA shRNA Plasmid DNA
lysozyme-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032517.4-350s21c1
Sequence:CCGGATTATGAGAGCGGCTACAACACTCGAGTGTTGTAGCCGCTCTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032517.4-392s21c1
Sequence:CCGGATGACGGCAGCATCGACTATGCTCGAGCATAGTCGATGCTGCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032517.4-624s21c1
Sequence:CCGGAGGCTGTGAGGTTTCCTAAACCTCGAGGTTTAGGAAACCTCACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-290s1c1
Sequence:CCGGCCTTGGAAACTGGATCTGCATCTCGAGATGCAGATCCAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-486s1c1
Sequence:CCGGGCAATTATCTGTGCCAGGAAACTCGAGTTTCCTGGCACAGATAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-522s1c1
Sequence:CCGGCAAGGAATGAACTATTGGCAACTCGAGTTGCCAATAGTTCATTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-171s1c1
Sequence:CCGGGCGGGCATTCTGACCCTCATTCTCGAGAATGAGGGTCAGAATGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-416s1c1
Sequence:CCGGCGGAAAGCTGAAGGAGAACAACTCGAGTTGTTCTCCTTCAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032517
LYZL1 MISSION shRNA Lentiviral Transduction Particles
lysozyme-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032517.4-350s21c1
Sequence:CCGGATTATGAGAGCGGCTACAACACTCGAGTGTTGTAGCCGCTCTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032517.4-392s21c1
Sequence:CCGGATGACGGCAGCATCGACTATGCTCGAGCATAGTCGATGCTGCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032517.4-624s21c1
Sequence:CCGGAGGCTGTGAGGTTTCCTAAACCTCGAGGTTTAGGAAACCTCACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-290s1c1
Sequence:CCGGCCTTGGAAACTGGATCTGCATCTCGAGATGCAGATCCAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-486s1c1
Sequence:CCGGGCAATTATCTGTGCCAGGAAACTCGAGTTTCCTGGCACAGATAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-522s1c1
Sequence:CCGGCAAGGAATGAACTATTGGCAACTCGAGTTGCCAATAGTTCATTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-171s1c1
Sequence:CCGGGCGGGCATTCTGACCCTCATTCTCGAGAATGAGGGTCAGAATGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032517.3-416s1c1
Sequence:CCGGCGGAAAGCTGAAGGAGAACAACTCGAGTTGTTCTCCTTCAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026092
LYZL1 MISSION shRNA Bacterial Glycerol Stock
lysozyme-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026092.1-622s1c1
Sequence:CCGGCCGTCAGACTTGTACTGAGTACTCGAGTACTCAGTACAAGTCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-208s1c1
Sequence:CCGGCACTCGATGTAAACTGGCAAACTCGAGTTTGCCAGTTTACATCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-496s1c1
Sequence:CCGGAGAGACACAAGGGATGAACTACTCGAGTAGTTCATCCCTTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-177s1c1
Sequence:CCGGGCTTCAGCATAGTCGCAGAATCTCGAGATTCTGCGACTATGCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-407s1c1
Sequence:CCGGCATCAGAAGAATCACTGCCATCTCGAGATGGCAGTGATTCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026092
LYZL1 MISSION shRNA shRNA Plasmid DNA
lysozyme-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026092.1-622s1c1
Sequence:CCGGCCGTCAGACTTGTACTGAGTACTCGAGTACTCAGTACAAGTCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-208s1c1
Sequence:CCGGCACTCGATGTAAACTGGCAAACTCGAGTTTGCCAGTTTACATCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-496s1c1
Sequence:CCGGAGAGACACAAGGGATGAACTACTCGAGTAGTTCATCCCTTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-177s1c1
Sequence:CCGGGCTTCAGCATAGTCGCAGAATCTCGAGATTCTGCGACTATGCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-407s1c1
Sequence:CCGGCATCAGAAGAATCACTGCCATCTCGAGATGGCAGTGATTCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026092
LYZL1 MISSION shRNA Lentiviral Transduction Particles
lysozyme-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026092.1-622s1c1
Sequence:CCGGCCGTCAGACTTGTACTGAGTACTCGAGTACTCAGTACAAGTCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-208s1c1
Sequence:CCGGCACTCGATGTAAACTGGCAAACTCGAGTTTGCCAGTTTACATCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-496s1c1
Sequence:CCGGAGAGACACAAGGGATGAACTACTCGAGTAGTTCATCCCTTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-177s1c1
Sequence:CCGGGCTTCAGCATAGTCGCAGAATCTCGAGATTCTGCGACTATGCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026092.1-407s1c1
Sequence:CCGGCATCAGAAGAATCACTGCCATCTCGAGATGGCAGTGATTCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks