EMAIL THIS PAGE TO A FRIEND

LZTFL1

leucine zipper transcription factor-like 1

Synonyms: BBS17
UniProtKB ID: Q9NQ48, Q8TC61, Q9NQ56
Gene ID:
Human(54585) Summary: This gene encodes a ubiquitously expressed protein that localizes to the cytoplasm. This protein interacts with Bardet-Biedl Syndrome (BBS) proteins and, through its interaction with BBS protein complexes, regulates protein trafficking to the ciliary membrane. Nonsense mutations in this gene cause a form of Bardet-Biedl Syndrome; a ciliopathy characterized in part by polydactyly, obesity, cognitive impairment, hypogonadism, and kidney failure. This gene may also function as a tumor suppressor; possibly by interacting with E-cadherin and the actin cytoskeleton and thereby regulating the transition of epithelial cells to mesenchymal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2013]
Mouse(93730) leucine zipper transcription factor-like 1
Rat(316102) leucine zipper transcription factor-like 1
sheep(101118737) leucine zipper transcription factor-like 1
naked mole-rat(101697012) leucine zipper transcription factor-like 1
domestic guinea pig(100715265) leucine zipper transcription factor-like 1
Zebrafish(322226) leucine zipper transcription factor-like 1
chicken(420698) leucine zipper transcription factor-like 1
domestic cat(101082984) leucine zipper transcription factor-like 1
cow(512570) leucine zipper transcription factor-like 1
dog(476651) leucine zipper transcription factor-like 1
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020347 Rosetta Predictions human pricing
NM_001024266 Rosetta Predictions rat pricing
NM_033322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185522 predicted 655
2 SASI_Hs01_00185523 predicted 493
3 SASI_Hs01_00185524 predicted 428
4 SASI_Hs01_00185525 predicted 985
5 SASI_Hs01_00185526 predicted 282
6 SASI_Hs01_00185527 predicted 360
7 SASI_Hs01_00185528 predicted 514
8 SASI_Hs01_00185529 predicted 294
9 SASI_Hs01_00185531 predicted 716
10 SASI_Hs02_00353281 predicted 712
11 SASI_Hs01_00185530 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066047 predicted 362
2 SASI_Rn01_00066048 predicted 623
3 SASI_Rn01_00066050 predicted 473
4 SASI_Rn01_00066051 predicted 466
5 SASI_Rn01_00066052 predicted 817
6 SASI_Rn01_00066053 predicted 965
7 SASI_Rn02_00202441 predicted 349
8 SASI_Rn01_00066054 predicted 350
9 SASI_Rn01_00066055 predicted 483
10 SASI_Rn01_00066056 predicted 262
11 SASI_Rn01_00066049 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337329 predicted 846
2 SASI_Mm02_00337330 predicted 440
3 SASI_Mm02_00337331 predicted 348
4 SASI_Mm02_00337332 predicted 294
5 SASI_Mm01_00142607 predicted 433
6 SASI_Mm02_00337333 predicted 407
7 SASI_Mm02_00337334 predicted 239
8 SASI_Mm02_00337335 predicted 535
9 SASI_Mm02_00337336 predicted 453
10 SASI_Mm01_00142608 predicted 427
11 SASI_Mm01_00142609 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033322
LZTFL1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper transcription factor-like 1
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-539s1c1
Sequence:CCGGCATTGAAATACAGGCTGTAAACTCGAGTTTACAGCCTGTATTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-675s1c1
Sequence:CCGGGCAACTCTTAGGAGTGAATTTCTCGAGAAATTCACTCCTAAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-434s1c1
Sequence:CCGGGCCTAAACTTGTTCCAATTAACTCGAGTTAATTGGAACAAGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033322.2-1167s1c1
Sequence:CCGGCCATGCAAGTACAGTGAGATTCTCGAGAATCTCACTGTACTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-538s1c1
Sequence:CCGGCCATTGAAATACAGGCTGTAACTCGAGTTACAGCCTGTATTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-235s21c1
Sequence:CCGGTGGAGTCCGAGCTCATCAATACTCGAGTATTGATGAGCTCGGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1918s21c1
Sequence:GTACCGGCATTTAACCGTCACGTGTTAACTCGAGTTAACACGTGACGGTTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-2199s21c1
Sequence:CCGGGGCAATCTTAGGATGATAAATCTCGAGATTTATCATCCTAAGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1585s21c1
Sequence:CCGGCGTATACTTTCACAGTTTAAACTCGAGTTTAAACTGTGAAAGTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1497s21c1
Sequence:CCGGCGTCATGAATGCTGCTTATTACTCGAGTAATAAGCAGCATTCATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-434s21c1
Sequence:CCGGGCCTAAACTTGTTCCAATTAACTCGAGTTAATTGGAACAAGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-538s21c1
Sequence:CCGGCCATTGAAATACAGGCTGTAACTCGAGTTACAGCCTGTATTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-299s21c1
Sequence:CCGGAGCTGAGAAGTGGTATCTAAACTCGAGTTTAGATACCACTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-186s21c1
Sequence:CCGGGAGGTTTCAGAAGTCCTAAATCTCGAGATTTAGGACTTCTGAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1415s21c1
Sequence:CCGGTTTCCACTCTAGTCAACATTTCTCGAGAAATGTTGACTAGAGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1285s21c1
Sequence:CCGGCTTGTACAGTCCCTAAGTATACTCGAGTATACTTAGGGACTGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033322
LZTFL1 MISSION shRNA shRNA Plasmid DNA
leucine zipper transcription factor-like 1
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-539s1c1
Sequence:CCGGCATTGAAATACAGGCTGTAAACTCGAGTTTACAGCCTGTATTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-675s1c1
Sequence:CCGGGCAACTCTTAGGAGTGAATTTCTCGAGAAATTCACTCCTAAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-434s1c1
Sequence:CCGGGCCTAAACTTGTTCCAATTAACTCGAGTTAATTGGAACAAGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033322.2-1167s1c1
Sequence:CCGGCCATGCAAGTACAGTGAGATTCTCGAGAATCTCACTGTACTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-538s1c1
Sequence:CCGGCCATTGAAATACAGGCTGTAACTCGAGTTACAGCCTGTATTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-235s21c1
Sequence:CCGGTGGAGTCCGAGCTCATCAATACTCGAGTATTGATGAGCTCGGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1918s21c1
Sequence:GTACCGGCATTTAACCGTCACGTGTTAACTCGAGTTAACACGTGACGGTTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-2199s21c1
Sequence:CCGGGGCAATCTTAGGATGATAAATCTCGAGATTTATCATCCTAAGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1585s21c1
Sequence:CCGGCGTATACTTTCACAGTTTAAACTCGAGTTTAAACTGTGAAAGTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1497s21c1
Sequence:CCGGCGTCATGAATGCTGCTTATTACTCGAGTAATAAGCAGCATTCATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-434s21c1
Sequence:CCGGGCCTAAACTTGTTCCAATTAACTCGAGTTAATTGGAACAAGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-538s21c1
Sequence:CCGGCCATTGAAATACAGGCTGTAACTCGAGTTACAGCCTGTATTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-299s21c1
Sequence:CCGGAGCTGAGAAGTGGTATCTAAACTCGAGTTTAGATACCACTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-186s21c1
Sequence:CCGGGAGGTTTCAGAAGTCCTAAATCTCGAGATTTAGGACTTCTGAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1415s21c1
Sequence:CCGGTTTCCACTCTAGTCAACATTTCTCGAGAAATGTTGACTAGAGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1285s21c1
Sequence:CCGGCTTGTACAGTCCCTAAGTATACTCGAGTATACTTAGGGACTGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033322
LZTFL1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper transcription factor-like 1
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-539s1c1
Sequence:CCGGCATTGAAATACAGGCTGTAAACTCGAGTTTACAGCCTGTATTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-675s1c1
Sequence:CCGGGCAACTCTTAGGAGTGAATTTCTCGAGAAATTCACTCCTAAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-434s1c1
Sequence:CCGGGCCTAAACTTGTTCCAATTAACTCGAGTTAATTGGAACAAGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033322.2-1167s1c1
Sequence:CCGGCCATGCAAGTACAGTGAGATTCTCGAGAATCTCACTGTACTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033322.2-538s1c1
Sequence:CCGGCCATTGAAATACAGGCTGTAACTCGAGTTACAGCCTGTATTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-235s21c1
Sequence:CCGGTGGAGTCCGAGCTCATCAATACTCGAGTATTGATGAGCTCGGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1918s21c1
Sequence:GTACCGGCATTTAACCGTCACGTGTTAACTCGAGTTAACACGTGACGGTTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-2199s21c1
Sequence:CCGGGGCAATCTTAGGATGATAAATCTCGAGATTTATCATCCTAAGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1585s21c1
Sequence:CCGGCGTATACTTTCACAGTTTAAACTCGAGTTTAAACTGTGAAAGTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1497s21c1
Sequence:CCGGCGTCATGAATGCTGCTTATTACTCGAGTAATAAGCAGCATTCATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-434s21c1
Sequence:CCGGGCCTAAACTTGTTCCAATTAACTCGAGTTAATTGGAACAAGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-538s21c1
Sequence:CCGGCCATTGAAATACAGGCTGTAACTCGAGTTACAGCCTGTATTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-299s21c1
Sequence:CCGGAGCTGAGAAGTGGTATCTAAACTCGAGTTTAGATACCACTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033322.2-186s21c1
Sequence:CCGGGAGGTTTCAGAAGTCCTAAATCTCGAGATTTAGGACTTCTGAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1415s21c1
Sequence:CCGGTTTCCACTCTAGTCAACATTTCTCGAGAAATGTTGACTAGAGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033322.2-1285s21c1
Sequence:CCGGCTTGTACAGTCCCTAAGTATACTCGAGTATACTTAGGGACTGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020347
LZTFL1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper transcription factor-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-353s1c1
Sequence:CCGGGCCTATACCAATGTGTTACTTCTCGAGAAGTAACACATTGGTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-184s1c1
Sequence:CCGGTGCTCGTTCAAAGAGAGGCTTCTCGAGAAGCCTCTCTTTGAACGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-633s1c1
Sequence:CCGGCCATTGAAATACAGGCTACAACTCGAGTTGTAGCCTGTATTTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-737s1c1
Sequence:CCGGGCCCAAGACTTAAGTAACTTACTCGAGTAAGTTACTTAAGTCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-929s1c1
Sequence:CCGGGCAGCTTATCGAAACATGAAACTCGAGTTTCATGTTTCGATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020347.2-570s21c1
Sequence:CCGGTGGAACAGCAGAACTCCTAAACTCGAGTTTAGGAGTTCTGCTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020347.2-1166s21c1
Sequence:CCGGTTAGAACTAGAGTTCCTATTTCTCGAGAAATAGGAACTCTAGTTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020347
LZTFL1 MISSION shRNA shRNA Plasmid DNA
leucine zipper transcription factor-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-353s1c1
Sequence:CCGGGCCTATACCAATGTGTTACTTCTCGAGAAGTAACACATTGGTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-184s1c1
Sequence:CCGGTGCTCGTTCAAAGAGAGGCTTCTCGAGAAGCCTCTCTTTGAACGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-633s1c1
Sequence:CCGGCCATTGAAATACAGGCTACAACTCGAGTTGTAGCCTGTATTTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-737s1c1
Sequence:CCGGGCCCAAGACTTAAGTAACTTACTCGAGTAAGTTACTTAAGTCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-929s1c1
Sequence:CCGGGCAGCTTATCGAAACATGAAACTCGAGTTTCATGTTTCGATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020347.2-570s21c1
Sequence:CCGGTGGAACAGCAGAACTCCTAAACTCGAGTTTAGGAGTTCTGCTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020347.2-1166s21c1
Sequence:CCGGTTAGAACTAGAGTTCCTATTTCTCGAGAAATAGGAACTCTAGTTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020347
LZTFL1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper transcription factor-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-353s1c1
Sequence:CCGGGCCTATACCAATGTGTTACTTCTCGAGAAGTAACACATTGGTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-184s1c1
Sequence:CCGGTGCTCGTTCAAAGAGAGGCTTCTCGAGAAGCCTCTCTTTGAACGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-633s1c1
Sequence:CCGGCCATTGAAATACAGGCTACAACTCGAGTTGTAGCCTGTATTTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-737s1c1
Sequence:CCGGGCCCAAGACTTAAGTAACTTACTCGAGTAAGTTACTTAAGTCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020347.1-929s1c1
Sequence:CCGGGCAGCTTATCGAAACATGAAACTCGAGTTTCATGTTTCGATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020347.2-570s21c1
Sequence:CCGGTGGAACAGCAGAACTCCTAAACTCGAGTTTAGGAGTTCTGCTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020347.2-1166s21c1
Sequence:CCGGTTAGAACTAGAGTTCCTATTTCTCGAGAAATAGGAACTCTAGTTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks