EMAIL THIS PAGE TO A FRIEND

MAB21L2

mab-21-like 2 (C. elegans)

UniProtKB ID: Q9Y586, B3KP37, Q9HBA7
Gene ID:
Human(10586) Summary: This gene is similar to the C. elegans MAB-21 cell fate-determining gene, a downstream target of transforming growth factor-beta signaling. It is thought that this gene may be involved in neural development. The protein encoded by this gene is primarily nuclear, although some cytoplasmic localization has been observed. [provided by RefSeq, Jul 2008]
Mouse(23937) mab-21-like 2 (C. elegans)
Rat(680102) mab-21-like 2 (C. elegans)
sheep(101106795) mab-21-like 2 (C. elegans)
domestic guinea pig(100723480) mab-21-like 2 (C. elegans)
naked mole-rat(101710930) mab-21-like 2 (C. elegans)
Zebrafish(117234) mab-21-like 2
domestic cat(101081726) mab-21-like 2 (C. elegans)
dog(482643) mab-21-like 2 (C. elegans)
cow(539225) mab-21-like 2 (C. elegans)
chicken(374011) mab-21-like 2 (C. elegans)
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049324 Anti-MAB21L2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006439 Rosetta Predictions human pricing
NM_001109391 Rosetta Predictions rat pricing
NM_011839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079000 predicted 1825
2 SASI_Hs01_00079001 predicted 1307
3 SASI_Hs01_00079003 predicted 1720
4 SASI_Hs01_00079004 predicted 1386
5 SASI_Hs01_00079005 predicted 1079
6 SASI_Hs01_00079006 predicted 1371
7 SASI_Hs01_00079007 predicted 1023
8 SASI_Hs01_00079008 predicted 1999
9 SASI_Hs01_00079009 predicted 1682
10 SASI_Hs02_00341574 predicted 1711
11 SASI_Hs01_00079002 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247956 predicted 1984
2 SASI_Rn02_00247957 predicted 1787
3 SASI_Rn02_00247958 predicted 1579
4 SASI_Rn02_00247959 predicted 1184
5 SASI_Rn02_00247960 predicted 1143
6 SASI_Rn02_00247961 predicted 1666
7 SASI_Rn02_00247962 predicted 2429
8 SASI_Rn02_00247963 predicted 2480
9 SASI_Rn02_00247964 predicted 1601
10 SASI_Rn02_00247965 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099058 predicted 1209
2 SASI_Mm01_00099059 predicted 1393
3 SASI_Mm01_00099060 predicted 1876
4 SASI_Mm01_00099061 predicted 1483
5 SASI_Mm01_00099062 predicted 1773
6 SASI_Mm01_00099063 predicted 607
7 SASI_Mm02_00321569 predicted 1788
8 SASI_Mm01_00099064 predicted 1625
9 SASI_Mm01_00099065 predicted 1895
10 SASI_Mm01_00099066 predicted 1101
11 SASI_Mm01_00099067 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006439
MAB21L2 MISSION shRNA Bacterial Glycerol Stock
mab-21-like 2 (C. elegans)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006439.4-2280s21c1
Sequence:CCGGTTATGTAAGTCACCTGAAATACTCGAGTATTTCAGGTGACTTACATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1683s1c1
Sequence:CCGGGCTCAACAACTACCACATGAACTCGAGTTCATGTGGTAGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1294s1c1
Sequence:CCGGGCGGTGGACAAGTGCAGCTATCTCGAGATAGCTGCACTTGTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-912s1c1
Sequence:CCGGGCTCAATAAGTACTACACTGACTCGAGTCAGTGTAGTACTTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1372s1c1
Sequence:CCGGCGCTATGTGGTGCAAATCACTCTCGAGAGTGATTTGCACCACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1921s1c1
Sequence:CCGGGAAATTCTCACCAATCCCAAACTCGAGTTTGGGATTGGTGAGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006439
MAB21L2 MISSION shRNA shRNA Plasmid DNA
mab-21-like 2 (C. elegans)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006439.4-2280s21c1
Sequence:CCGGTTATGTAAGTCACCTGAAATACTCGAGTATTTCAGGTGACTTACATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1683s1c1
Sequence:CCGGGCTCAACAACTACCACATGAACTCGAGTTCATGTGGTAGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1294s1c1
Sequence:CCGGGCGGTGGACAAGTGCAGCTATCTCGAGATAGCTGCACTTGTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-912s1c1
Sequence:CCGGGCTCAATAAGTACTACACTGACTCGAGTCAGTGTAGTACTTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1372s1c1
Sequence:CCGGCGCTATGTGGTGCAAATCACTCTCGAGAGTGATTTGCACCACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1921s1c1
Sequence:CCGGGAAATTCTCACCAATCCCAAACTCGAGTTTGGGATTGGTGAGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006439
MAB21L2 MISSION shRNA Lentiviral Transduction Particles
mab-21-like 2 (C. elegans)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006439.4-2280s21c1
Sequence:CCGGTTATGTAAGTCACCTGAAATACTCGAGTATTTCAGGTGACTTACATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1683s1c1
Sequence:CCGGGCTCAACAACTACCACATGAACTCGAGTTCATGTGGTAGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1294s1c1
Sequence:CCGGGCGGTGGACAAGTGCAGCTATCTCGAGATAGCTGCACTTGTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-912s1c1
Sequence:CCGGGCTCAATAAGTACTACACTGACTCGAGTCAGTGTAGTACTTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1372s1c1
Sequence:CCGGCGCTATGTGGTGCAAATCACTCTCGAGAGTGATTTGCACCACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006439.3-1921s1c1
Sequence:CCGGGAAATTCTCACCAATCCCAAACTCGAGTTTGGGATTGGTGAGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011839
VALIDATED
MAB21L2 MISSION shRNA Bacterial Glycerol Stock
mab-21-like 2 (C. elegans)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011839.2-626s1c1
Sequence:CCGGGCTCAATAAATACTACACCGACTCGAGTCGGTGTAGTATTTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011839.2-833s1c1
Sequence:CCGGCAACCAGATGGGAGTCTTCAACTCGAGTTGAAGACTCCCATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011839.2-1327s1c1
Sequence:CCGGGCTGTAGAAACAAGTGCCTCTCTCGAGAGAGGCACTTGTTTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011839.2-836s1c1
Sequence:CCGGCCAGATGGGAGTCTTCAACTTCTCGAGAAGTTGAAGACTCCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011839.2-1886s1c1
Sequence:CCGGCCTTCCAAACAATGTGAATTTCTCGAGAAATTCACATTGTTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011839.2-2322s1c1
Sequence:CCGGGCTTCCATTTGAACTCTGATTCTCGAGAATCAGAGTTCAAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011839
VALIDATED
MAB21L2 MISSION shRNA shRNA Plasmid DNA
mab-21-like 2 (C. elegans)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011839.2-626s1c1
Sequence:CCGGGCTCAATAAATACTACACCGACTCGAGTCGGTGTAGTATTTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011839.2-833s1c1
Sequence:CCGGCAACCAGATGGGAGTCTTCAACTCGAGTTGAAGACTCCCATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011839.2-1327s1c1
Sequence:CCGGGCTGTAGAAACAAGTGCCTCTCTCGAGAGAGGCACTTGTTTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011839.2-836s1c1
Sequence:CCGGCCAGATGGGAGTCTTCAACTTCTCGAGAAGTTGAAGACTCCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011839.2-1886s1c1
Sequence:CCGGCCTTCCAAACAATGTGAATTTCTCGAGAAATTCACATTGTTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011839.2-2322s1c1
Sequence:CCGGGCTTCCATTTGAACTCTGATTCTCGAGAATCAGAGTTCAAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011839
VALIDATED
MAB21L2 MISSION shRNA Lentiviral Transduction Particles
mab-21-like 2 (C. elegans)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011839.2-626s1c1
Sequence:CCGGGCTCAATAAATACTACACCGACTCGAGTCGGTGTAGTATTTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011839.2-833s1c1
Sequence:CCGGCAACCAGATGGGAGTCTTCAACTCGAGTTGAAGACTCCCATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011839.2-1327s1c1
Sequence:CCGGGCTGTAGAAACAAGTGCCTCTCTCGAGAGAGGCACTTGTTTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011839.2-836s1c1
Sequence:CCGGCCAGATGGGAGTCTTCAACTTCTCGAGAAGTTGAAGACTCCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011839.2-1886s1c1
Sequence:CCGGCCTTCCAAACAATGTGAATTTCTCGAGAAATTCACATTGTTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011839.2-2322s1c1
Sequence:CCGGGCTTCCATTTGAACTCTGATTCTCGAGAATCAGAGTTCAAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks