EMAIL THIS PAGE TO A FRIEND

MAD1L1

MAD1 mitotic arrest deficient-like 1 (yeast)

Synonyms: MAD1 PIG9 TP53I9 TXBP181
UniProtKB ID: Q9Y6D9, Q13312, Q75MI0, Q86UM4, Q9UNH0
Gene ID:
Human(8379) Summary: MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17120) MAD1 mitotic arrest deficient 1-like 1
Rat(680006) MAD1 mitotic arrest deficient-like 1 (yeast)
Zebrafish(393886) MAD1 mitotic arrest deficient-like 1
cow(517837) MAD1 mitotic arrest deficient-like 1 (yeast)
Horse(100058904) MAD1 mitotic arrest deficient-like 1 (yeast)
domestic cat(101086024) MAD1 mitotic arrest deficient-like 1 (yeast)
dog(609673) MAD1 mitotic arrest deficient-like 1 (yeast)
chicken(427658) MAD1 mitotic arrest deficient-like 1 (yeast)
domestic guinea pig(100731466) MAD1 mitotic arrest deficient-like 1 (yeast)
naked mole-rat(101711604) MAD1 mitotic arrest deficient-like 1 (yeast)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003550 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130191 MISSION® esiRNA esiRNA human MAD1L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013836 Rosetta Predictions human pricing
NM_001013837 Rosetta Predictions human pricing
NM_003550 Rosetta Predictions human pricing
NM_001109387 Rosetta Predictions rat pricing
NM_010752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186452 predicted 1878
2 SASI_Hs01_00186453 predicted 920
3 SASI_Hs01_00186454 predicted 2078
4 SASI_Hs01_00186456 predicted 2163
5 SASI_Hs01_00186457 predicted 984
6 SASI_Hs01_00186458 predicted 678
7 SASI_Hs01_00186459 predicted 971
8 SASI_Hs01_00186460 predicted 1686
9 SASI_Hs02_00306493 predicted 1720
10 SASI_Hs02_00306494 predicted 1387
11 SASI_Hs01_00186455 predicted 486
12 SASI_Hs01_00186461 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058281 predicted 1869
2 SASI_Hs01_00058282 predicted 914
3 SASI_Hs01_00058283 predicted 2077
4 SASI_Hs01_00058285 predicted 2154
5 SASI_Hs01_00058286 predicted 981
6 SASI_Hs01_00058287 predicted 681
7 SASI_Hs01_00058288 predicted 966
8 SASI_Hs01_00058289 predicted 1688
9 SASI_Hs02_00306495 predicted 1716
10 SASI_Hs02_00306496 predicted 1379
11 SASI_Hs01_00058284 predicted 481
12 SASI_Hs01_00058290 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158694 predicted 1914
2 SASI_Hs01_00158695 predicted 953
3 SASI_Hs01_00158696 predicted 2124
4 SASI_Hs01_00158698 predicted 2191
5 SASI_Hs01_00158699 predicted 1016
6 SASI_Hs01_00158700 predicted 718
7 SASI_Hs01_00158701 predicted 1007
8 SASI_Hs01_00158702 predicted 1726
9 SASI_Hs02_00335822 predicted 1761
10 SASI_Hs02_00335823 predicted 1424
11 SASI_Hs01_00158697 predicted 523
12 SASI_Hs01_00158703 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247916 predicted 1634
2 SASI_Rn02_00247917 predicted 700
3 SASI_Rn02_00247918 predicted 1665
4 SASI_Rn02_00247919 predicted 640
5 SASI_Rn02_00247920 predicted 2174
6 SASI_Rn02_00247921 predicted 945
7 SASI_Rn02_00247922 predicted 1047
8 SASI_Rn02_00247923 predicted 2192
9 SASI_Rn02_00247924 predicted 689
10 SASI_Rn02_00247925 predicted 2246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200461 predicted 338
2 SASI_Mm01_00200462 predicted 523
3 SASI_Mm02_00319271 predicted 849
4 SASI_Mm01_00200463 predicted 648
5 SASI_Mm01_00200464 predicted 2180
6 SASI_Mm01_00200465 predicted 1639
7 SASI_Mm01_00200466 predicted 1509
8 SASI_Mm01_00200467 predicted 838
9 SASI_Mm01_00200468 predicted 1691
10 SASI_Mm01_00200469 predicted 1055
11 SASI_Mm01_00200460 predicted 1692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010752
VALIDATED
MAD1L1 MISSION shRNA Bacterial Glycerol Stock
MAD1 mitotic arrest deficient-like 1 (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-717s21c1
Sequence:CCGGGAGCATGAGCAGAAGATTAAGCTCGAGCTTAATCTTCTGCTCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-113s21c1
Sequence:CCGGCAACTTCATTTCTCAGCGAATCTCGAGATTCGCTGAGAAATGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-2442s21c1
Sequence:CCGGGATGACCAAGCCAGATCATACCTCGAGGTATGATCTGGCTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-1517s21c1
Sequence:CCGGAGCTGAATCTAGCTTCTCATTCTCGAGAATGAGAAGCTAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-2199s21c1
Sequence:CCGGCAGACCTCTATCTAGCCTCTTCTCGAGAAGAGGCTAGATAGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-2115s1c1
Sequence:CCGGCAGACCTCTATCTAGCCTCTTCTCGAGAAGAGGCTAGATAGAGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-530s1c1
Sequence:CCGGCCAGGGAGATGATTAGTTCATCTCGAGATGAACTAATCATCTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-1524s1c1
Sequence:CCGGAGCTGAATCTAGCTTCTCATTCTCGAGAATGAGAAGCTAGATTCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-120s1c1
Sequence:CCGGCAACTTCATTTCTCAGCGAATCTCGAGATTCGCTGAGAAATGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010752.1-1384s1c1
Sequence:CCGGGACATGGTTCAGAAGGTACATCTCGAGATGTACCTTCTGAACCATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010752
VALIDATED
MAD1L1 MISSION shRNA shRNA Plasmid DNA
MAD1 mitotic arrest deficient-like 1 (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-717s21c1
Sequence:CCGGGAGCATGAGCAGAAGATTAAGCTCGAGCTTAATCTTCTGCTCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-113s21c1
Sequence:CCGGCAACTTCATTTCTCAGCGAATCTCGAGATTCGCTGAGAAATGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-2442s21c1
Sequence:CCGGGATGACCAAGCCAGATCATACCTCGAGGTATGATCTGGCTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-1517s21c1
Sequence:CCGGAGCTGAATCTAGCTTCTCATTCTCGAGAATGAGAAGCTAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-2199s21c1
Sequence:CCGGCAGACCTCTATCTAGCCTCTTCTCGAGAAGAGGCTAGATAGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-2115s1c1
Sequence:CCGGCAGACCTCTATCTAGCCTCTTCTCGAGAAGAGGCTAGATAGAGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-530s1c1
Sequence:CCGGCCAGGGAGATGATTAGTTCATCTCGAGATGAACTAATCATCTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-1524s1c1
Sequence:CCGGAGCTGAATCTAGCTTCTCATTCTCGAGAATGAGAAGCTAGATTCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-120s1c1
Sequence:CCGGCAACTTCATTTCTCAGCGAATCTCGAGATTCGCTGAGAAATGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010752.1-1384s1c1
Sequence:CCGGGACATGGTTCAGAAGGTACATCTCGAGATGTACCTTCTGAACCATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010752
VALIDATED
MAD1L1 MISSION shRNA Lentiviral Transduction Particles
MAD1 mitotic arrest deficient-like 1 (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-717s21c1
Sequence:CCGGGAGCATGAGCAGAAGATTAAGCTCGAGCTTAATCTTCTGCTCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-113s21c1
Sequence:CCGGCAACTTCATTTCTCAGCGAATCTCGAGATTCGCTGAGAAATGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-2442s21c1
Sequence:CCGGGATGACCAAGCCAGATCATACCTCGAGGTATGATCTGGCTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-1517s21c1
Sequence:CCGGAGCTGAATCTAGCTTCTCATTCTCGAGAATGAGAAGCTAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010752.3-2199s21c1
Sequence:CCGGCAGACCTCTATCTAGCCTCTTCTCGAGAAGAGGCTAGATAGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-2115s1c1
Sequence:CCGGCAGACCTCTATCTAGCCTCTTCTCGAGAAGAGGCTAGATAGAGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-530s1c1
Sequence:CCGGCCAGGGAGATGATTAGTTCATCTCGAGATGAACTAATCATCTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-1524s1c1
Sequence:CCGGAGCTGAATCTAGCTTCTCATTCTCGAGAATGAGAAGCTAGATTCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010752.1-120s1c1
Sequence:CCGGCAACTTCATTTCTCAGCGAATCTCGAGATTCGCTGAGAAATGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010752.1-1384s1c1
Sequence:CCGGGACATGGTTCAGAAGGTACATCTCGAGATGTACCTTCTGAACCATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003550
VALIDATED
MAD1L1 MISSION shRNA Bacterial Glycerol Stock
MAD1 mitotic arrest deficient-like 1 (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003550.2-384s21c1
Sequence:CCGGAGGCTCTGGACTGGATATTTCCTCGAGGAAATATCCAGTCCAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003550.2-771s21c1
Sequence:CCGGCGAGACCATCAACGCACTGAACTCGAGTTCAGTGCGTTGATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003550.2-961s21c1
Sequence:CCGGGACCACGAGCAGCAGATTAAGCTCGAGCTTAATCTGCTGCTCGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003550.2-727s21c1
Sequence:CCGGAGCAAGAGGCTGCGTGAGAAACTCGAGTTTCTCACGCAGCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003550.2-903s21c1
Sequence:CCGGATGCCAGGAAGCCAATCAGAACTCGAGTTCTGATTGGCTTCCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003550.1-1211s1c1
Sequence:CCGGGCTTGCCTTGAAGGACAAGAACTCGAGTTCTTGTCCTTCAAGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_003550.1-218s1c1
Sequence:CCGGCCTGAGATCTTTGAACAACTTCTCGAGAAGTTGTTCAAAGATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003550.1-1571s1c1
Sequence:CCGGCCAGAAACAAAGAGCAGACATCTCGAGATGTCTGCTCTTTGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003550.1-353s1c1
Sequence:CCGGCCGTTCGAAGTCCCACCTCATCTCGAGATGAGGTGGGACTTCGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_003550.1-896s1c1
Sequence:CCGGAGCGATTGTGAAGAACATGAACTCGAGTTCATGTTCTTCACAATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003550
VALIDATED
MAD1L1 MISSION shRNA shRNA Plasmid DNA
MAD1 mitotic arrest deficient-like 1 (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003550.2-384s21c1
Sequence:CCGGAGGCTCTGGACTGGATATTTCCTCGAGGAAATATCCAGTCCAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003550.2-771s21c1
Sequence:CCGGCGAGACCATCAACGCACTGAACTCGAGTTCAGTGCGTTGATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003550.2-961s21c1
Sequence:CCGGGACCACGAGCAGCAGATTAAGCTCGAGCTTAATCTGCTGCTCGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003550.2-727s21c1
Sequence:CCGGAGCAAGAGGCTGCGTGAGAAACTCGAGTTTCTCACGCAGCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003550.2-903s21c1
Sequence:CCGGATGCCAGGAAGCCAATCAGAACTCGAGTTCTGATTGGCTTCCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003550.1-1211s1c1
Sequence:CCGGGCTTGCCTTGAAGGACAAGAACTCGAGTTCTTGTCCTTCAAGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_003550.1-218s1c1
Sequence:CCGGCCTGAGATCTTTGAACAACTTCTCGAGAAGTTGTTCAAAGATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003550.1-1571s1c1
Sequence:CCGGCCAGAAACAAAGAGCAGACATCTCGAGATGTCTGCTCTTTGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003550.1-353s1c1
Sequence:CCGGCCGTTCGAAGTCCCACCTCATCTCGAGATGAGGTGGGACTTCGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_003550.1-896s1c1
Sequence:CCGGAGCGATTGTGAAGAACATGAACTCGAGTTCATGTTCTTCACAATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003550
VALIDATED
MAD1L1 MISSION shRNA Lentiviral Transduction Particles
MAD1 mitotic arrest deficient-like 1 (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003550.2-384s21c1
Sequence:CCGGAGGCTCTGGACTGGATATTTCCTCGAGGAAATATCCAGTCCAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003550.2-771s21c1
Sequence:CCGGCGAGACCATCAACGCACTGAACTCGAGTTCAGTGCGTTGATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003550.2-961s21c1
Sequence:CCGGGACCACGAGCAGCAGATTAAGCTCGAGCTTAATCTGCTGCTCGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003550.2-727s21c1
Sequence:CCGGAGCAAGAGGCTGCGTGAGAAACTCGAGTTTCTCACGCAGCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003550.2-903s21c1
Sequence:CCGGATGCCAGGAAGCCAATCAGAACTCGAGTTCTGATTGGCTTCCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003550.1-1211s1c1
Sequence:CCGGGCTTGCCTTGAAGGACAAGAACTCGAGTTCTTGTCCTTCAAGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_003550.1-218s1c1
Sequence:CCGGCCTGAGATCTTTGAACAACTTCTCGAGAAGTTGTTCAAAGATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003550.1-1571s1c1
Sequence:CCGGCCAGAAACAAAGAGCAGACATCTCGAGATGTCTGCTCTTTGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003550.1-353s1c1
Sequence:CCGGCCGTTCGAAGTCCCACCTCATCTCGAGATGAGGTGGGACTTCGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_003550.1-896s1c1
Sequence:CCGGAGCGATTGTGAAGAACATGAACTCGAGTTCATGTTCTTCACAATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks