EMAIL THIS PAGE TO A FRIEND

MAD2L1

MAD2 mitotic arrest deficient-like 1 (yeast)

Synonyms: HSMAD2 MAD2
UniProtKB ID: Q13257, Q53F56, Q548X9, Q6IRW7, Q8IZX3
Gene ID:
Human(4085) Summary: MAD2L1 is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. MAD2L1 is related to the MAD2L2 gene located on chromosome 1. A MAD2 pseudogene has been mapped to chromosome 14. [provided by RefSeq, Jul 2008]
Mouse(56150) MAD2 mitotic arrest deficient-like 1
Rat(297176) MAD2 mitotic arrest deficient-like 1 (yeast)
Zebrafish(550434) MAD2 mitotic arrest deficient-like 1 (yeast)
domestic cat(101092847) MAD2 mitotic arrest deficient-like 1 (yeast)
cow(337870) MAD2 mitotic arrest deficient-like 1 (yeast)
dog(476070) MAD2 mitotic arrest deficient-like 1 (yeast)
chicken(422675) MAD2 mitotic arrest deficient-like 1 (yeast)
domestic guinea pig(100731050) MAD2 mitotic arrest deficient-like 1 (yeast)
sheep(101109094) MAD2 mitotic arrest deficient-like 1 (yeast)
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0015 AQUA Peptide DLVVPE[K] chicken, dog, human, mouse, rat pricing
AQ0014 AQUA Peptide YLNNVVEQL[K] dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002358 siRNAs that have been validated in the lab human pricing
NM_001106594 Rosetta Predictions rat pricing
NM_019499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002358 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042213 validated 504
2 SASI_Hs01_00042212 predicted 613
3 SASI_Hs01_00042214 predicted 258
4 SASI_Hs01_00042215 predicted 470
5 SASI_Hs01_00042217 predicted 448
6 SASI_Hs01_00042220 predicted 627
7 SASI_Hs01_00042221 predicted 292
8 SASI_Hs02_00333694 predicted 290
9 SASI_Hs02_00333695 predicted 532
10 SASI_Hs02_00333696 predicted 425
11 SASI_Hs01_00042216 predicted 361
12 SASI_Hs01_00042218 predicted 238
13 SASI_Hs01_00042219 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220488 predicted 440
2 SASI_Rn02_00220489 predicted 295
3 SASI_Rn02_00220490 predicted 556
4 SASI_Rn02_00220491 predicted 211
5 SASI_Rn02_00220492 predicted 690
6 SASI_Rn02_00220493 predicted 409
7 SASI_Rn02_00220494 predicted 757
8 SASI_Rn02_00220495 predicted 663
9 SASI_Rn02_00220496 predicted 480
10 SASI_Rn02_00220497 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030200 predicted 433
2 SASI_Mm01_00030201 predicted 235
3 SASI_Mm01_00030202 predicted 731
4 SASI_Mm01_00030203 predicted 741
5 SASI_Mm01_00030204 predicted 744
6 SASI_Mm01_00030205 predicted 341
7 SASI_Mm01_00030206 predicted 233
8 SASI_Mm01_00030207 predicted 524
9 SASI_Mm01_00030208 predicted 700
10 SASI_Mm01_00030209 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019499
MAD2L1 MISSION shRNA Bacterial Glycerol Stock
MAD2 mitotic arrest deficient-like 1 (yeast)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019499.2-995s1c1
Sequence:CCGGCCAGGATATAAAGAAGCGTTTCTCGAGAAACGCTTCTTTATATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-198s1c1
Sequence:CCGGGCAGAAATATGGACTCACCTTCTCGAGAAGGTGAGTCCATATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-164s1c1
Sequence:CCGGGTGGCATTTATCCGTCGGAAACTCGAGTTTCCGACGGATAAATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-572s1c1
Sequence:CCGGGACCGCAATTTATTACCAATTCTCGAGAATTGGTAATAAATTGCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-446s1c1
Sequence:CCGGGCTCAGTGATTAGACAGATTACTCGAGTAATCTGTCTAATCACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019499.4-1062s21c1
Sequence:CCGGTCAGTCAGGAATGTTGCCAATCTCGAGATTGGCAACATTCCTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019499.4-982s21c1
Sequence:CCGGATTGTAACTGGACCAGGATATCTCGAGATATCCTGGTCCAGTTACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019499.4-965s21c1
Sequence:CCGGTAACTACTTCCCTTAACATTGCTCGAGCAATGTTAAGGGAAGTAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019499
MAD2L1 MISSION shRNA shRNA Plasmid DNA
MAD2 mitotic arrest deficient-like 1 (yeast)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019499.2-995s1c1
Sequence:CCGGCCAGGATATAAAGAAGCGTTTCTCGAGAAACGCTTCTTTATATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-198s1c1
Sequence:CCGGGCAGAAATATGGACTCACCTTCTCGAGAAGGTGAGTCCATATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-164s1c1
Sequence:CCGGGTGGCATTTATCCGTCGGAAACTCGAGTTTCCGACGGATAAATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-572s1c1
Sequence:CCGGGACCGCAATTTATTACCAATTCTCGAGAATTGGTAATAAATTGCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-446s1c1
Sequence:CCGGGCTCAGTGATTAGACAGATTACTCGAGTAATCTGTCTAATCACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019499.4-1062s21c1
Sequence:CCGGTCAGTCAGGAATGTTGCCAATCTCGAGATTGGCAACATTCCTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019499.4-982s21c1
Sequence:CCGGATTGTAACTGGACCAGGATATCTCGAGATATCCTGGTCCAGTTACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019499.4-965s21c1
Sequence:CCGGTAACTACTTCCCTTAACATTGCTCGAGCAATGTTAAGGGAAGTAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019499
MAD2L1 MISSION shRNA Lentiviral Transduction Particles
MAD2 mitotic arrest deficient-like 1 (yeast)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019499.2-995s1c1
Sequence:CCGGCCAGGATATAAAGAAGCGTTTCTCGAGAAACGCTTCTTTATATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-198s1c1
Sequence:CCGGGCAGAAATATGGACTCACCTTCTCGAGAAGGTGAGTCCATATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-164s1c1
Sequence:CCGGGTGGCATTTATCCGTCGGAAACTCGAGTTTCCGACGGATAAATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-572s1c1
Sequence:CCGGGACCGCAATTTATTACCAATTCTCGAGAATTGGTAATAAATTGCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019499.2-446s1c1
Sequence:CCGGGCTCAGTGATTAGACAGATTACTCGAGTAATCTGTCTAATCACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019499.4-1062s21c1
Sequence:CCGGTCAGTCAGGAATGTTGCCAATCTCGAGATTGGCAACATTCCTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019499.4-982s21c1
Sequence:CCGGATTGTAACTGGACCAGGATATCTCGAGATATCCTGGTCCAGTTACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019499.4-965s21c1
Sequence:CCGGTAACTACTTCCCTTAACATTGCTCGAGCAATGTTAAGGGAAGTAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002358
VALIDATED
MAD2L1 MISSION shRNA Bacterial Glycerol Stock
MAD2 mitotic arrest deficient-like 1 (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002358.2-1197s1c1
Sequence:CCGGCCTATTGAATCAGTTTCCAATCTCGAGATTGGAAACTGATTCAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002358.2-619s1c1
Sequence:CCGGGCCTTCGTTCATTTACTACTACTCGAGTAGTAGTAAATGAACGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002358.2-531s1c1
Sequence:CCGGCTGCTGATTTATACAGACAAACTCGAGTTTGTCTGTATAAATCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002358.2-177s1c1
Sequence:CCGGCGTGGCATATATCCATCTGAACTCGAGTTCAGATGGATATATGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002358.2-137s1c1
Sequence:CCGGCGAGTTCTTCTCATTCGGCATCTCGAGATGCCGAATGAGAAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-630s21c1
Sequence:CCGGAGTCGGGACCACAGTTTATTACTCGAGTAATAAACTGTGGTCCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-187s21c1
Sequence:CCGGCGAGTTCTTCTCATTCGGCATCTCGAGATGCCGAATGAGAAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-669s21c1
Sequence:CCGGGCCTTCGTTCATTTACTACTACTCGAGTAGTAGTAAATGAACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-292s21c1
Sequence:CCGGTACTGATCTTGAGCTCATAAACTCGAGTTTATGAGCTCAAGATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-1248s21c1
Sequence:CCGGCCTATTGAATCAGTTTCCAATCTCGAGATTGGAAACTGATTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002358
VALIDATED
MAD2L1 MISSION shRNA shRNA Plasmid DNA
MAD2 mitotic arrest deficient-like 1 (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002358.2-1197s1c1
Sequence:CCGGCCTATTGAATCAGTTTCCAATCTCGAGATTGGAAACTGATTCAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002358.2-619s1c1
Sequence:CCGGGCCTTCGTTCATTTACTACTACTCGAGTAGTAGTAAATGAACGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002358.2-531s1c1
Sequence:CCGGCTGCTGATTTATACAGACAAACTCGAGTTTGTCTGTATAAATCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002358.2-177s1c1
Sequence:CCGGCGTGGCATATATCCATCTGAACTCGAGTTCAGATGGATATATGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002358.2-137s1c1
Sequence:CCGGCGAGTTCTTCTCATTCGGCATCTCGAGATGCCGAATGAGAAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-630s21c1
Sequence:CCGGAGTCGGGACCACAGTTTATTACTCGAGTAATAAACTGTGGTCCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-187s21c1
Sequence:CCGGCGAGTTCTTCTCATTCGGCATCTCGAGATGCCGAATGAGAAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-669s21c1
Sequence:CCGGGCCTTCGTTCATTTACTACTACTCGAGTAGTAGTAAATGAACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-292s21c1
Sequence:CCGGTACTGATCTTGAGCTCATAAACTCGAGTTTATGAGCTCAAGATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-1248s21c1
Sequence:CCGGCCTATTGAATCAGTTTCCAATCTCGAGATTGGAAACTGATTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002358
VALIDATED
MAD2L1 MISSION shRNA Lentiviral Transduction Particles
MAD2 mitotic arrest deficient-like 1 (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002358.2-1197s1c1
Sequence:CCGGCCTATTGAATCAGTTTCCAATCTCGAGATTGGAAACTGATTCAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002358.2-619s1c1
Sequence:CCGGGCCTTCGTTCATTTACTACTACTCGAGTAGTAGTAAATGAACGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002358.2-531s1c1
Sequence:CCGGCTGCTGATTTATACAGACAAACTCGAGTTTGTCTGTATAAATCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002358.2-177s1c1
Sequence:CCGGCGTGGCATATATCCATCTGAACTCGAGTTCAGATGGATATATGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002358.2-137s1c1
Sequence:CCGGCGAGTTCTTCTCATTCGGCATCTCGAGATGCCGAATGAGAAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-630s21c1
Sequence:CCGGAGTCGGGACCACAGTTTATTACTCGAGTAATAAACTGTGGTCCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-187s21c1
Sequence:CCGGCGAGTTCTTCTCATTCGGCATCTCGAGATGCCGAATGAGAAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-669s21c1
Sequence:CCGGGCCTTCGTTCATTTACTACTACTCGAGTAGTAGTAAATGAACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-292s21c1
Sequence:CCGGTACTGATCTTGAGCTCATAAACTCGAGTTTATGAGCTCAAGATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002358.3-1248s21c1
Sequence:CCGGCCTATTGAATCAGTTTCCAATCTCGAGATTGGAAACTGATTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks