EMAIL THIS PAGE TO A FRIEND

MAGEB1

melanoma antigen family B, 1

Synonyms: CT3.1 DAM10 MAGE-Xp MAGEL1
UniProtKB ID: P43366, B2RC79, O00601, O75862, Q6FHJ0, Q96CW8
Gene ID:
Human(4112) Summary: This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is localized in the DSS (dosage-sensitive sex reversal) critical region, and expressed in testis and in a significant fraction of tumors of various histological types. This gene and other MAGEB members are clustered on chromosome Xp22-p21. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene, however, the full length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Mouse(17145) melanoma antigen, family B, 1
Rat(302748) melanoma antigen family B, 1
cow(782877) melanoma antigen family B, 1
dog(491803) melanoma antigen family B, 1
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002363 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002363 Rosetta Predictions human pricing
NM_177404 Rosetta Predictions human pricing
NM_177415 Rosetta Predictions human pricing
XM_001061869 Rosetta Predictions rat pricing
XM_229040 Rosetta Predictions rat pricing
NM_010759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058551 predicted 847
2 SASI_Hs01_00058552 predicted 972
3 SASI_Hs01_00058553 predicted 663
4 SASI_Hs01_00058554 predicted 1438
5 SASI_Hs01_00058555 predicted 1366
6 SASI_Hs01_00058556 predicted 1205
7 SASI_Hs01_00058557 predicted 661
8 SASI_Hs01_00058558 predicted 547
9 SASI_Hs01_00058559 predicted 1043
10 SASI_Hs01_00058560 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235636 predicted 686
2 SASI_Hs01_00235637 predicted 817
3 SASI_Hs01_00235638 predicted 511
4 SASI_Hs01_00235639 predicted 1284
5 SASI_Hs01_00235640 predicted 1206
6 SASI_Hs01_00235641 predicted 1047
7 SASI_Hs01_00235642 predicted 508
8 SASI_Hs01_00235643 predicted 388
9 SASI_Hs01_00235644 predicted 879
10 SASI_Hs01_00235645 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092436 predicted 768
2 SASI_Hs01_00092437 predicted 886
3 SASI_Hs01_00092438 predicted 581
4 SASI_Hs01_00092439 predicted 1360
5 SASI_Hs01_00092440 predicted 1283
6 SASI_Hs01_00092441 predicted 1120
7 SASI_Hs01_00092442 predicted 585
8 SASI_Hs01_00092443 predicted 464
9 SASI_Hs01_00092444 predicted 959
10 SASI_Hs01_00092445 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301574 predicted 205
2 SASI_Rn02_00301575 predicted 204
3 SASI_Rn02_00301576 predicted 268
4 SASI_Rn02_00301577 predicted 1104
5 SASI_Rn02_00301578 predicted 360
6 SASI_Rn02_00301579 predicted 1069
7 SASI_Rn02_00301580 predicted 264
8 SASI_Rn02_00301581 predicted 261
9 SASI_Rn02_00301582 predicted 435
10 SASI_Rn02_00301583 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385724 predicted 213
2 SASI_Rn02_00385725 predicted 207
3 SASI_Rn02_00385726 predicted 267
4 SASI_Rn02_00385727 predicted 1103
5 SASI_Rn02_00385728 predicted 359
6 SASI_Rn02_00385729 predicted 1073
7 SASI_Rn02_00385730 predicted 263
8 SASI_Rn02_00385731 predicted 257
9 SASI_Rn02_00385732 predicted 433
10 SASI_Rn02_00385733 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087520 predicted 487
2 SASI_Mm01_00087521 predicted 520
3 SASI_Mm01_00087522 predicted 444
4 SASI_Mm02_00319281 predicted 900
5 SASI_Mm01_00087524 predicted 513
6 SASI_Mm01_00087526 predicted 460
7 SASI_Mm02_00319282 predicted 336
8 SASI_Mm01_00087528 predicted 739
9 SASI_Mm01_00087529 predicted 653
10 SASI_Mm02_00319283 predicted 436
11 SASI_Mm01_00087523 predicted 778
12 SASI_Mm01_00087525 predicted 351
13 SASI_Mm01_00087527 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010759
MAGEB1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-596s21c1
Sequence:CCGGCACGCCTAGAATTAGTCTTTGCTCGAGCAAAGACTAATTCTAGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-541s21c1
Sequence:CCGGGTAGTTAACAAGAAGTATAAGCTCGAGCTTATACTTCTTGTTAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-355s21c1
Sequence:CCGGTCTGGTATAGGTGGTAGAAATCTCGAGATTTCTACCACCTATACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-688s21c1
Sequence:CCGGGAGGGAAGTTTGAGTAGTAACCTCGAGGTTACTACTCAAACTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-32s1c1
Sequence:CCGGCTCCATTAAGTCCAAGGTATTCTCGAGAATACCTTGGACTTAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-71s1c1
Sequence:CCGGAGGTACTTACAGGTTGTCATTCTCGAGAATGACAACCTGTAAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-44s1c1
Sequence:CCGGCAAGGTATTCTCTACCTGGTACTCGAGTACCAGGTAGAGAATACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-58s1c1
Sequence:CCGGCCTGGTAGTACAGAGGTACTTCTCGAGAAGTACCTCTGTACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-86s1c1
Sequence:CCGGGTCATTCTTATCCTTCCAGATCTCGAGATCTGGAAGGATAAGAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010759
MAGEB1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-596s21c1
Sequence:CCGGCACGCCTAGAATTAGTCTTTGCTCGAGCAAAGACTAATTCTAGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-541s21c1
Sequence:CCGGGTAGTTAACAAGAAGTATAAGCTCGAGCTTATACTTCTTGTTAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-355s21c1
Sequence:CCGGTCTGGTATAGGTGGTAGAAATCTCGAGATTTCTACCACCTATACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-688s21c1
Sequence:CCGGGAGGGAAGTTTGAGTAGTAACCTCGAGGTTACTACTCAAACTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-32s1c1
Sequence:CCGGCTCCATTAAGTCCAAGGTATTCTCGAGAATACCTTGGACTTAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-71s1c1
Sequence:CCGGAGGTACTTACAGGTTGTCATTCTCGAGAATGACAACCTGTAAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-44s1c1
Sequence:CCGGCAAGGTATTCTCTACCTGGTACTCGAGTACCAGGTAGAGAATACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-58s1c1
Sequence:CCGGCCTGGTAGTACAGAGGTACTTCTCGAGAAGTACCTCTGTACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-86s1c1
Sequence:CCGGGTCATTCTTATCCTTCCAGATCTCGAGATCTGGAAGGATAAGAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010759
MAGEB1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-596s21c1
Sequence:CCGGCACGCCTAGAATTAGTCTTTGCTCGAGCAAAGACTAATTCTAGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-541s21c1
Sequence:CCGGGTAGTTAACAAGAAGTATAAGCTCGAGCTTATACTTCTTGTTAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-355s21c1
Sequence:CCGGTCTGGTATAGGTGGTAGAAATCTCGAGATTTCTACCACCTATACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010759.1-688s21c1
Sequence:CCGGGAGGGAAGTTTGAGTAGTAACCTCGAGGTTACTACTCAAACTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-32s1c1
Sequence:CCGGCTCCATTAAGTCCAAGGTATTCTCGAGAATACCTTGGACTTAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-71s1c1
Sequence:CCGGAGGTACTTACAGGTTGTCATTCTCGAGAATGACAACCTGTAAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-44s1c1
Sequence:CCGGCAAGGTATTCTCTACCTGGTACTCGAGTACCAGGTAGAGAATACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-58s1c1
Sequence:CCGGCCTGGTAGTACAGAGGTACTTCTCGAGAAGTACCTCTGTACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010759.1-86s1c1
Sequence:CCGGGTCATTCTTATCCTTCCAGATCTCGAGATCTGGAAGGATAAGAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002363
MAGEB1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002363.3-552s1c1
Sequence:CCGGGAATCTGACGAAGGTGCCAAACTCGAGTTTGGCACCTTCGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002363.3-894s1c1
Sequence:CCGGGATTGGGACTTTCCCAGGAATCTCGAGATTCCTGGGAAAGTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002363.3-665s1c1
Sequence:CCGGGATGCACTTCATTCTACGTAACTCGAGTTACGTAGAATGAAGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002363.3-714s1c1
Sequence:CCGGGCAGATATGCTGAAGGTTGTTCTCGAGAACAACCTTCAGCATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167202    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002363.3-1582s1c1
Sequence:CCGGCCAGCTTTAAGCATAAGAGTTCTCGAGAACTCTTATGCTTAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002363.3-1659s1c1
Sequence:CCGGGCATAGCTTTAGAATAGAGATCTCGAGATCTCTATTCTAAAGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002363.3-1708s1c1
Sequence:CCGGCACAACATAATTGGAGTCTTACTCGAGTAAGACTCCAATTATGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002363.3-854s1c1
Sequence:CCGGCAGTAAGCTAAACCTCACCAACTCGAGTTGGTGAGGTTTAGCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002363
MAGEB1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002363.3-552s1c1
Sequence:CCGGGAATCTGACGAAGGTGCCAAACTCGAGTTTGGCACCTTCGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002363.3-894s1c1
Sequence:CCGGGATTGGGACTTTCCCAGGAATCTCGAGATTCCTGGGAAAGTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002363.3-665s1c1
Sequence:CCGGGATGCACTTCATTCTACGTAACTCGAGTTACGTAGAATGAAGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002363.3-714s1c1
Sequence:CCGGGCAGATATGCTGAAGGTTGTTCTCGAGAACAACCTTCAGCATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167202    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002363.3-1582s1c1
Sequence:CCGGCCAGCTTTAAGCATAAGAGTTCTCGAGAACTCTTATGCTTAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002363.3-1659s1c1
Sequence:CCGGGCATAGCTTTAGAATAGAGATCTCGAGATCTCTATTCTAAAGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002363.3-1708s1c1
Sequence:CCGGCACAACATAATTGGAGTCTTACTCGAGTAAGACTCCAATTATGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002363.3-854s1c1
Sequence:CCGGCAGTAAGCTAAACCTCACCAACTCGAGTTGGTGAGGTTTAGCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002363
MAGEB1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002363.3-552s1c1
Sequence:CCGGGAATCTGACGAAGGTGCCAAACTCGAGTTTGGCACCTTCGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002363.3-894s1c1
Sequence:CCGGGATTGGGACTTTCCCAGGAATCTCGAGATTCCTGGGAAAGTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002363.3-665s1c1
Sequence:CCGGGATGCACTTCATTCTACGTAACTCGAGTTACGTAGAATGAAGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002363.3-714s1c1
Sequence:CCGGGCAGATATGCTGAAGGTTGTTCTCGAGAACAACCTTCAGCATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167202    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002363.3-1582s1c1
Sequence:CCGGCCAGCTTTAAGCATAAGAGTTCTCGAGAACTCTTATGCTTAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002363.3-1659s1c1
Sequence:CCGGGCATAGCTTTAGAATAGAGATCTCGAGATCTCTATTCTAAAGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002363.3-1708s1c1
Sequence:CCGGCACAACATAATTGGAGTCTTACTCGAGTAAGACTCCAATTATGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002363.3-854s1c1
Sequence:CCGGCAGTAAGCTAAACCTCACCAACTCGAGTTGGTGAGGTTTAGCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks