EMAIL THIS PAGE TO A FRIEND

MAGEC3

melanoma antigen family C, 3

Synonyms: CT7.2 HCA2 MAGE-C3 MAGEC4
Species: Human MAGEC3(139081)
UniProtKB ID: Q8TD91, Q3SYA7, Q5JZ43, Q9BZ80
Gene ID:
Human(139081) Summary: This gene is a member of the MAGEC gene family. The members of this family are not expressed in normal tissues, except for testis, and are expressed in tumors of various histological types. The MAGEC genes are clustered on chromosome Xq26-q27. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138702 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086751 MISSION® esiRNA esiRNA human MAGEC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138702 Rosetta Predictions human pricing
NM_177456 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130801 predicted 1493
2 SASI_Hs01_00130802 predicted 1506
3 SASI_Hs01_00130803 predicted 1354
4 SASI_Hs01_00130805 predicted 1378
5 SASI_Hs01_00130807 predicted 1339
6 SASI_Hs01_00130808 predicted 1488
7 SASI_Hs01_00130809 predicted 1495
8 SASI_Hs01_00130810 predicted 1352
9 SASI_Hs02_00363801 predicted 1317
10 SASI_Hs02_00363802 predicted 1332
11 SASI_Hs01_00130804 predicted 1326
12 SASI_Hs01_00130806 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181502 predicted 1133
2 SASI_Hs01_00181503 predicted 1138
3 SASI_Hs01_00181504 predicted 984
4 SASI_Hs01_00181505 predicted 1006
5 SASI_Hs01_00181507 predicted 974
6 SASI_Hs01_00181508 predicted 1120
7 SASI_Hs01_00181509 predicted 1130
8 SASI_Hs01_00181510 predicted 981
9 SASI_Hs01_00181511 predicted 954
10 SASI_Hs02_00369350 predicted 964
11 SASI_Hs01_00181506 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138702
MAGEC3 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family C, 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-736s1c1
Sequence:CCGGCCCGACCATTTCTATGTCTTTCTCGAGAAAGACATAGAAATGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1554s1c1
Sequence:CCGGCGACAACCACTCCTATTTCTTCTCGAGAAGAAATAGGAGTGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1744s1c1
Sequence:CCGGGCAAGAGAAGTCTTAGAGTTTCTCGAGAAACTCTAAGACTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1504s1c1
Sequence:CCGGCATGAGTTCATAGAGCTAATTCTCGAGAATTAGCTCTATGAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1503s1c1
Sequence:CCGGCCATGAGTTCATAGAGCTAATCTCGAGATTAGCTCTATGAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138702.1-1595s21c1
Sequence:CCGGCCTATGAGGGAAGCCTGATTGCTCGAGCAATCAGGCTTCCCTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138702.1-1656s21c1
Sequence:CCGGTCTCAGTATGATCTTCATAAACTCGAGTTTATGAAGATCATACTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138702
MAGEC3 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family C, 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-736s1c1
Sequence:CCGGCCCGACCATTTCTATGTCTTTCTCGAGAAAGACATAGAAATGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1554s1c1
Sequence:CCGGCGACAACCACTCCTATTTCTTCTCGAGAAGAAATAGGAGTGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1744s1c1
Sequence:CCGGGCAAGAGAAGTCTTAGAGTTTCTCGAGAAACTCTAAGACTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1504s1c1
Sequence:CCGGCATGAGTTCATAGAGCTAATTCTCGAGAATTAGCTCTATGAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1503s1c1
Sequence:CCGGCCATGAGTTCATAGAGCTAATCTCGAGATTAGCTCTATGAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138702.1-1595s21c1
Sequence:CCGGCCTATGAGGGAAGCCTGATTGCTCGAGCAATCAGGCTTCCCTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138702.1-1656s21c1
Sequence:CCGGTCTCAGTATGATCTTCATAAACTCGAGTTTATGAAGATCATACTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138702
MAGEC3 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family C, 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-736s1c1
Sequence:CCGGCCCGACCATTTCTATGTCTTTCTCGAGAAAGACATAGAAATGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1554s1c1
Sequence:CCGGCGACAACCACTCCTATTTCTTCTCGAGAAGAAATAGGAGTGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1744s1c1
Sequence:CCGGGCAAGAGAAGTCTTAGAGTTTCTCGAGAAACTCTAAGACTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1504s1c1
Sequence:CCGGCATGAGTTCATAGAGCTAATTCTCGAGAATTAGCTCTATGAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138702.1-1503s1c1
Sequence:CCGGCCATGAGTTCATAGAGCTAATCTCGAGATTAGCTCTATGAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138702.1-1595s21c1
Sequence:CCGGCCTATGAGGGAAGCCTGATTGCTCGAGCAATCAGGCTTCCCTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138702.1-1656s21c1
Sequence:CCGGTCTCAGTATGATCTTCATAAACTCGAGTTTATGAAGATCATACTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks