EMAIL THIS PAGE TO A FRIEND

MAGEL2

MAGE-like 2

Synonyms: NDNL1 nM15
UniProtKB ID: Q9UJ55
Gene ID:
Human(54551) Summary: Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]
Mouse(27385) melanoma antigen, family L, 2
Rat(679875) MAGE-like 2
cow(538665) MAGE-like 2
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019066 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019066 Rosetta Predictions human pricing
XM_001054803 Rosetta Predictions rat pricing
XM_622091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352655 predicted 1783
2 SASI_Hs01_00142256 predicted 1436
3 SASI_Hs02_00352656 predicted 1705
4 SASI_Hs01_00142258 predicted 1711
5 SASI_Hs02_00352657 predicted 441
6 SASI_Hs01_00142260 predicted 1460
7 SASI_Hs01_00142261 predicted 1354
8 SASI_Hs01_00142262 predicted 1540
9 SASI_Hs01_00142263 predicted 1589
10 SASI_Hs01_00142264 predicted 1617
11 SASI_Hs01_00142255 predicted 555
12 SASI_Hs01_00142257 predicted 1678
13 SASI_Hs01_00142259 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277326 predicted 831
2 SASI_Rn02_00277327 predicted 998
3 SASI_Rn02_00277328 predicted 1906
4 SASI_Rn02_00277329 predicted 3449
5 SASI_Rn02_00277330 predicted 3090
6 SASI_Rn02_00277331 predicted 3408
7 SASI_Rn02_00277332 predicted 3511
8 SASI_Rn02_00277333 predicted 3247
9 SASI_Rn02_00277334 predicted 1566
10 SASI_Rn02_00277335 predicted 1623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205076 predicted 4216
2 SASI_Mm02_00427872 predicted 1376
3 SASI_Mm02_00427873 predicted 1204
4 SASI_Mm01_00205078 predicted 3893
5 SASI_Mm01_00205079 predicted 3037
6 SASI_Mm01_00205081 predicted 3966
7 SASI_Mm01_00205082 predicted 3252
8 SASI_Mm01_00205083 predicted 3960
9 SASI_Mm01_00205084 predicted 3527
10 SASI_Mm01_00205085 predicted 3770
11 SASI_Mm01_00205077 predicted 4255
12 SASI_Mm01_00205080 predicted 3046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019066
MAGEL2 MISSION shRNA Bacterial Glycerol Stock
MAGE-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019066.2-2128s1c1
Sequence:CCGGGCTGGCTTTGTGAAATGAATTCTCGAGAATTCATTTCACAAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-616s1c1
Sequence:CCGGGCCCAATATGAATGCCTCAAACTCGAGTTTGAGGCATTCATATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-1528s1c1
Sequence:CCGGCCGGGAGACAAACGGTCTCTTCTCGAGAAGAGACCGTTTGTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-1573s1c1
Sequence:CCGGCGAAGTGTTTGTCAGGCAGAACTCGAGTTCTGCCTGACAAACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-1354s1c1
Sequence:CCGGCGCCTATATTATCATCAACAACTCGAGTTGTTGATGATAATATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019066
MAGEL2 MISSION shRNA shRNA Plasmid DNA
MAGE-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019066.2-2128s1c1
Sequence:CCGGGCTGGCTTTGTGAAATGAATTCTCGAGAATTCATTTCACAAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-616s1c1
Sequence:CCGGGCCCAATATGAATGCCTCAAACTCGAGTTTGAGGCATTCATATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-1528s1c1
Sequence:CCGGCCGGGAGACAAACGGTCTCTTCTCGAGAAGAGACCGTTTGTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-1573s1c1
Sequence:CCGGCGAAGTGTTTGTCAGGCAGAACTCGAGTTCTGCCTGACAAACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-1354s1c1
Sequence:CCGGCGCCTATATTATCATCAACAACTCGAGTTGTTGATGATAATATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019066
MAGEL2 MISSION shRNA Lentiviral Transduction Particles
MAGE-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019066.2-2128s1c1
Sequence:CCGGGCTGGCTTTGTGAAATGAATTCTCGAGAATTCATTTCACAAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-616s1c1
Sequence:CCGGGCCCAATATGAATGCCTCAAACTCGAGTTTGAGGCATTCATATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-1528s1c1
Sequence:CCGGCCGGGAGACAAACGGTCTCTTCTCGAGAAGAGACCGTTTGTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-1573s1c1
Sequence:CCGGCGAAGTGTTTGTCAGGCAGAACTCGAGTTCTGCCTGACAAACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019066.2-1354s1c1
Sequence:CCGGCGCCTATATTATCATCAACAACTCGAGTTGTTGATGATAATATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013779
MAGEL2 MISSION shRNA Bacterial Glycerol Stock
MAGE-like 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-1270s21c1
Sequence:CCGGGTGCCAGAGGTCCAATCATTCCTCGAGGAATGATTGGACCTCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-4220s21c1
Sequence:CCGGTCACTAATAGACGTTACTAAGCTCGAGCTTAGTAACGTCTATTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013779.2-4465s21c1
Sequence:CCGGTTCCCTGTTTGGTGTACTAATCTCGAGATTAGTACACCAAACAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-2961s21c1
Sequence:CCGGTTTGCTCTGCAGGATCCTTATCTCGAGATAAGGATCCTGCAGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-3746s21c1
Sequence:CCGGGGCGTACCCTCAGTGTAATTTCTCGAGAAATTACACTGAGGGTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-4135s21c1
Sequence:CCGGTAGAATACAAGGACGCAAATGCTCGAGCATTTGCGTCCTTGTATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-1370s21c1
Sequence:CCGGTCAGCCTTTGATCCTACAAATCTCGAGATTTGTAGGATCAAAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-3499s21c1
Sequence:CCGGATAGGGAGAGTCAGCCCTTATCTCGAGATAAGGGCTGACTCTCCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013779
MAGEL2 MISSION shRNA shRNA Plasmid DNA
MAGE-like 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-1270s21c1
Sequence:CCGGGTGCCAGAGGTCCAATCATTCCTCGAGGAATGATTGGACCTCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-4220s21c1
Sequence:CCGGTCACTAATAGACGTTACTAAGCTCGAGCTTAGTAACGTCTATTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013779.2-4465s21c1
Sequence:CCGGTTCCCTGTTTGGTGTACTAATCTCGAGATTAGTACACCAAACAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-2961s21c1
Sequence:CCGGTTTGCTCTGCAGGATCCTTATCTCGAGATAAGGATCCTGCAGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-3746s21c1
Sequence:CCGGGGCGTACCCTCAGTGTAATTTCTCGAGAAATTACACTGAGGGTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-4135s21c1
Sequence:CCGGTAGAATACAAGGACGCAAATGCTCGAGCATTTGCGTCCTTGTATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-1370s21c1
Sequence:CCGGTCAGCCTTTGATCCTACAAATCTCGAGATTTGTAGGATCAAAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-3499s21c1
Sequence:CCGGATAGGGAGAGTCAGCCCTTATCTCGAGATAAGGGCTGACTCTCCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013779
MAGEL2 MISSION shRNA Lentiviral Transduction Particles
MAGE-like 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-1270s21c1
Sequence:CCGGGTGCCAGAGGTCCAATCATTCCTCGAGGAATGATTGGACCTCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-4220s21c1
Sequence:CCGGTCACTAATAGACGTTACTAAGCTCGAGCTTAGTAACGTCTATTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013779.2-4465s21c1
Sequence:CCGGTTCCCTGTTTGGTGTACTAATCTCGAGATTAGTACACCAAACAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-2961s21c1
Sequence:CCGGTTTGCTCTGCAGGATCCTTATCTCGAGATAAGGATCCTGCAGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-3746s21c1
Sequence:CCGGGGCGTACCCTCAGTGTAATTTCTCGAGAAATTACACTGAGGGTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-4135s21c1
Sequence:CCGGTAGAATACAAGGACGCAAATGCTCGAGCATTTGCGTCCTTGTATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-1370s21c1
Sequence:CCGGTCAGCCTTTGATCCTACAAATCTCGAGATTTGTAGGATCAAAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013779.2-3499s21c1
Sequence:CCGGATAGGGAGAGTCAGCCCTTATCTCGAGATAAGGGCTGACTCTCCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks