EMAIL THIS PAGE TO A FRIEND

MALT1

mucosa associated lymphoid tissue lymphoma translocation gene 1

Synonyms: MLT MLT1
UniProtKB ID: Q9UDY8, Q9NTB7, Q9ULX4
Gene ID:
Human(10892) Summary: This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(240354) mucosa associated lymphoid tissue lymphoma translocation gene 1
Rat(307366) mucosa associated lymphoid tissue lymphoma translocation gene 1
chicken(415336) mucosa associated lymphoid tissue lymphoma translocation gene 1
domestic cat(101088885) mucosa associated lymphoid tissue lymphoma translocation gene 1
cow(504994) mucosa associated lymphoid tissue lymphoma translocation gene 1
Horse(100054579) mucosa associated lymphoid tissue lymphoma translocation gene 1
dog(476188) mucosa associated lymphoid tissue lymphoma translocation gene 1
sheep(101116274) mucosa associated lymphoid tissue lymphoma translocation gene 1
naked mole-rat(101718499) mucosa associated lymphoid tissue lymphoma translocation gene 1
domestic guinea pig(100729667) mucosa associated lymphoid tissue lymphoma translocation gene 1
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006785 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006785 Rosetta Predictions human pricing
NM_173844 Rosetta Predictions human pricing
XM_001060470 Rosetta Predictions rat pricing
XM_001060526 Rosetta Predictions rat pricing
XM_225927 Rosetta Predictions rat pricing
NM_172833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342305 predicted 2672
2 SASI_Hs01_00123500 predicted 1960
3 SASI_Hs01_00123501 predicted 1833
4 SASI_Hs01_00123502 predicted 2297
5 SASI_Hs01_00123503 predicted 1901
6 SASI_Hs01_00123504 predicted 1716
7 SASI_Hs01_00123505 predicted 2533
8 SASI_Hs01_00123506 predicted 1417
9 SASI_Hs01_00123507 predicted 1679
10 SASI_Hs01_00123508 predicted 2256
11 SASI_Hs01_00123499 predicted 2309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125784 predicted 2269
2 SASI_Hs01_00125785 predicted 1936
3 SASI_Hs01_00125786 predicted 1802
4 SASI_Hs01_00125787 predicted 2260
5 SASI_Hs01_00125788 predicted 1863
6 SASI_Hs01_00125789 predicted 1684
7 SASI_Hs01_00125790 predicted 2505
8 SASI_Hs01_00125791 predicted 1375
9 SASI_Hs01_00125792 predicted 1647
10 SASI_Hs01_00125793 predicted 2220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296620 predicted 1833
2 SASI_Rn02_00296621 predicted 2315
3 SASI_Rn02_00296622 predicted 1767
4 SASI_Rn02_00296623 predicted 1081
5 SASI_Rn02_00296624 predicted 922
6 SASI_Rn02_00296625 predicted 2585
7 SASI_Rn02_00296626 predicted 2563
8 SASI_Rn02_00296627 predicted 1007
9 SASI_Rn02_00296628 predicted 1043
10 SASI_Rn02_00296629 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296842 predicted 1801
2 SASI_Rn02_00296843 predicted 2278
3 SASI_Rn02_00296844 predicted 1737
4 SASI_Rn02_00296845 predicted 917
5 SASI_Rn02_00296846 predicted 2551
6 SASI_Rn02_00296847 predicted 2536
7 SASI_Rn02_00296848 predicted 1006
8 SASI_Rn02_00296849 predicted 1044
9 SASI_Rn02_00296850 predicted 1557
10 SASI_Rn02_00296851 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383250 predicted 445
2 SASI_Rn02_00383251 predicted 1268
3 SASI_Rn02_00383252 predicted 1084
4 SASI_Rn02_00383253 predicted 473
5 SASI_Rn02_00383254 predicted 923
6 SASI_Rn02_00383255 predicted 1011
7 SASI_Rn02_00383256 predicted 1043
8 SASI_Rn02_00383257 predicted 1092
9 SASI_Rn02_00383258 predicted 685
10 SASI_Rn02_00383259 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176600 predicted 1104
2 SASI_Mm01_00176602 predicted 1737
3 SASI_Mm01_00176603 predicted 2584
4 SASI_Mm01_00176604 predicted 2542
5 SASI_Mm01_00176605 predicted 1309
6 SASI_Mm02_00344764 predicted 935
7 SASI_Mm01_00176606 predicted 1840
8 SASI_Mm01_00176607 predicted 1572
9 SASI_Mm01_00176608 predicted 963
10 SASI_Mm01_00176609 predicted 2562
11 SASI_Mm01_00176601 predicted 1061
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006785
VALIDATED
MALT1 MISSION shRNA Bacterial Glycerol Stock
mucosa associated lymphoid tissue lymphoma translocation gene 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006785.2-3177s1c1
Sequence:CCGGCCAGAAATCTATTCCAGTATTCTCGAGAATACTGGAATAGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006785.2-1024s1c1
Sequence:CCGGCCTCACTACCAGTGGTTCAAACTCGAGTTTGAACCACTGGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006785.2-2125s1c1
Sequence:CCGGCCGGAGATAATAATGTGTGATCTCGAGATCACACATTATTATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006785.2-1665s1c1
Sequence:CCGGCTACGATGATACCATTCCAATCTCGAGATTGGAATGGTATCATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006785.2-1969s1c2
Sequence:CCGGGCTGAATCTCTTGTGCGGAATCTCGAGATTCCGCACAAGAGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-2084s21c1
Sequence:CCGGCCAATGTCATGATCATCTATACTCGAGTATAGATGATCATGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-1469s21c1
Sequence:CCGGAGGGAGTATATGGGTTATTATCTCGAGATAATAACCCATATACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-2548s21c1
Sequence:CCGGCATCCTGGTAATCCAAGTAATCTCGAGATTACTTGGATTACCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-1542s21c1
Sequence:CCGGTGATGCTCCAAATCCATATAGCTCGAGCTATATGGATTTGGAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006785.2-4567s21c1
Sequence:CCGGAGGATCAACTGTACCATATTTCTCGAGAAATATGGTACAGTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-1355s21c1
Sequence:CCGGTGTACGAATTGACTAACTTACCTCGAGGTAAGTTAGTCAATTCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006785.2-3096s21c1
Sequence:CCGGTCACCAGGCATAACCTAATTTCTCGAGAAATTAGGTTATGCCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-826s21c1
Sequence:CCGGTGTCGAGTTAATAACAATTTCCTCGAGGAAATTGTTATTAACTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006785
VALIDATED
MALT1 MISSION shRNA shRNA Plasmid DNA
mucosa associated lymphoid tissue lymphoma translocation gene 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006785.2-3177s1c1
Sequence:CCGGCCAGAAATCTATTCCAGTATTCTCGAGAATACTGGAATAGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006785.2-1024s1c1
Sequence:CCGGCCTCACTACCAGTGGTTCAAACTCGAGTTTGAACCACTGGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006785.2-2125s1c1
Sequence:CCGGCCGGAGATAATAATGTGTGATCTCGAGATCACACATTATTATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006785.2-1665s1c1
Sequence:CCGGCTACGATGATACCATTCCAATCTCGAGATTGGAATGGTATCATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006785.2-1969s1c2
Sequence:CCGGGCTGAATCTCTTGTGCGGAATCTCGAGATTCCGCACAAGAGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-2084s21c1
Sequence:CCGGCCAATGTCATGATCATCTATACTCGAGTATAGATGATCATGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-1469s21c1
Sequence:CCGGAGGGAGTATATGGGTTATTATCTCGAGATAATAACCCATATACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-2548s21c1
Sequence:CCGGCATCCTGGTAATCCAAGTAATCTCGAGATTACTTGGATTACCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-1542s21c1
Sequence:CCGGTGATGCTCCAAATCCATATAGCTCGAGCTATATGGATTTGGAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006785.2-4567s21c1
Sequence:CCGGAGGATCAACTGTACCATATTTCTCGAGAAATATGGTACAGTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-1355s21c1
Sequence:CCGGTGTACGAATTGACTAACTTACCTCGAGGTAAGTTAGTCAATTCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006785.2-3096s21c1
Sequence:CCGGTCACCAGGCATAACCTAATTTCTCGAGAAATTAGGTTATGCCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-826s21c1
Sequence:CCGGTGTCGAGTTAATAACAATTTCCTCGAGGAAATTGTTATTAACTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006785
VALIDATED
MALT1 MISSION shRNA Lentiviral Transduction Particles
mucosa associated lymphoid tissue lymphoma translocation gene 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006785.2-3177s1c1
Sequence:CCGGCCAGAAATCTATTCCAGTATTCTCGAGAATACTGGAATAGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006785.2-1024s1c1
Sequence:CCGGCCTCACTACCAGTGGTTCAAACTCGAGTTTGAACCACTGGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006785.2-2125s1c1
Sequence:CCGGCCGGAGATAATAATGTGTGATCTCGAGATCACACATTATTATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006785.2-1665s1c1
Sequence:CCGGCTACGATGATACCATTCCAATCTCGAGATTGGAATGGTATCATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006785.2-1969s1c2
Sequence:CCGGGCTGAATCTCTTGTGCGGAATCTCGAGATTCCGCACAAGAGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-2084s21c1
Sequence:CCGGCCAATGTCATGATCATCTATACTCGAGTATAGATGATCATGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-1469s21c1
Sequence:CCGGAGGGAGTATATGGGTTATTATCTCGAGATAATAACCCATATACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-2548s21c1
Sequence:CCGGCATCCTGGTAATCCAAGTAATCTCGAGATTACTTGGATTACCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-1542s21c1
Sequence:CCGGTGATGCTCCAAATCCATATAGCTCGAGCTATATGGATTTGGAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006785.2-4567s21c1
Sequence:CCGGAGGATCAACTGTACCATATTTCTCGAGAAATATGGTACAGTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-1355s21c1
Sequence:CCGGTGTACGAATTGACTAACTTACCTCGAGGTAAGTTAGTCAATTCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006785.2-3096s21c1
Sequence:CCGGTCACCAGGCATAACCTAATTTCTCGAGAAATTAGGTTATGCCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006785.2-826s21c1
Sequence:CCGGTGTCGAGTTAATAACAATTTCCTCGAGGAAATTGTTATTAACTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172833
VALIDATED
MALT1 MISSION shRNA Bacterial Glycerol Stock
mucosa associated lymphoid tissue lymphoma translocation gene 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172833.1-4183s1c1
Sequence:CCGGCCTCCCATATTACTCACCAATCTCGAGATTGGTGAGTAATATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172833.1-1616s1c1
Sequence:CCGGGCCAACATTGTGTTTGGATATCTCGAGATATCCAAACACAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172833.1-2578s1c1
Sequence:CCGGCGTAGAGACAACTGATGAAATCTCGAGATTTCATCAGTTGTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172833.1-2513s1c1
Sequence:CCGGCCACACACATTCATTTCAAATCTCGAGATTTGAAATGAATGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172833.1-566s1c1
Sequence:CCGGCCAGGATTAAAGATCACTGTACTCGAGTACAGTGATCTTTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172833.2-1450s21c1
Sequence:CCGGTGATGCTCCAAATCCATATAGCTCGAGCTATATGGATTTGGAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172833.2-2775s21c1
Sequence:CCGGGATGTTGGAATTACGTTATTTCTCGAGAAATAACGTAATTCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172833.2-3057s21c1
Sequence:CCGGGGTACAGTGCTCAGCTAATATCTCGAGATATTAGCTGAGCACTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172833
VALIDATED
MALT1 MISSION shRNA shRNA Plasmid DNA
mucosa associated lymphoid tissue lymphoma translocation gene 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172833.1-4183s1c1
Sequence:CCGGCCTCCCATATTACTCACCAATCTCGAGATTGGTGAGTAATATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172833.1-1616s1c1
Sequence:CCGGGCCAACATTGTGTTTGGATATCTCGAGATATCCAAACACAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172833.1-2578s1c1
Sequence:CCGGCGTAGAGACAACTGATGAAATCTCGAGATTTCATCAGTTGTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172833.1-2513s1c1
Sequence:CCGGCCACACACATTCATTTCAAATCTCGAGATTTGAAATGAATGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172833.1-566s1c1
Sequence:CCGGCCAGGATTAAAGATCACTGTACTCGAGTACAGTGATCTTTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172833.2-1450s21c1
Sequence:CCGGTGATGCTCCAAATCCATATAGCTCGAGCTATATGGATTTGGAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172833.2-2775s21c1
Sequence:CCGGGATGTTGGAATTACGTTATTTCTCGAGAAATAACGTAATTCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172833.2-3057s21c1
Sequence:CCGGGGTACAGTGCTCAGCTAATATCTCGAGATATTAGCTGAGCACTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172833
VALIDATED
MALT1 MISSION shRNA Lentiviral Transduction Particles
mucosa associated lymphoid tissue lymphoma translocation gene 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172833.1-4183s1c1
Sequence:CCGGCCTCCCATATTACTCACCAATCTCGAGATTGGTGAGTAATATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172833.1-1616s1c1
Sequence:CCGGGCCAACATTGTGTTTGGATATCTCGAGATATCCAAACACAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172833.1-2578s1c1
Sequence:CCGGCGTAGAGACAACTGATGAAATCTCGAGATTTCATCAGTTGTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172833.1-2513s1c1
Sequence:CCGGCCACACACATTCATTTCAAATCTCGAGATTTGAAATGAATGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172833.1-566s1c1
Sequence:CCGGCCAGGATTAAAGATCACTGTACTCGAGTACAGTGATCTTTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172833.2-1450s21c1
Sequence:CCGGTGATGCTCCAAATCCATATAGCTCGAGCTATATGGATTTGGAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172833.2-2775s21c1
Sequence:CCGGGATGTTGGAATTACGTTATTTCTCGAGAAATAACGTAATTCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172833.2-3057s21c1
Sequence:CCGGGGTACAGTGCTCAGCTAATATCTCGAGATATTAGCTGAGCACTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks