EMAIL THIS PAGE TO A FRIEND

MAMLD1

mastermind-like domain containing 1

Synonyms: CG1 CXorf6 F18 HYSP2
UniProtKB ID: Q13495, B2RCQ4, B4DG93, B9EGA5
Gene ID:
Human(10046) Summary: This gene encodes a mastermind-like domain containing protein. This protein may function as a transcriptional co-activator. Mutations in this gene are the cause of X-linked hypospadias type 2. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Mouse(333639) mastermind-like domain containing 1
sheep(101115096) mastermind-like domain containing 1
naked mole-rat(101696770) mastermind-like domain containing 1
domestic guinea pig(100725248) mastermind-like domain containing 1
chicken(422389) mastermind-like domain containing 1
dog(100685170) mastermind-like domain containing 1
cow(100139912) mastermind-like domain containing 1
Horse(100069293) mastermind-like domain containing 1
domestic cat(101097957) mastermind-like domain containing 1
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34221 Anti-CXORF6 antibody produced in rabbit IgG fraction of antiserum , mouse, human, horse, guinea pig, canine, rabbit
western blot pricing
SAB2104145 Anti-CXORF6, (N-terminal) antibody produced in rabbit affinity isolated antibody canine, human, guinea pig, horse, rabbit, bovine, mouse
western blot pricing
HPA003923 Anti-MAMLD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005491 Rosetta Predictions human pricing
NM_001081354 Rosetta Predictions mouse pricing
XM_898704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113257 predicted 2103
2 SASI_Hs01_00113259 predicted 524
3 SASI_Hs02_00339685 predicted 505
4 SASI_Hs01_00113260 predicted 330
5 SASI_Hs01_00113261 predicted 471
6 SASI_Hs01_00113262 predicted 2370
7 SASI_Hs01_00113263 predicted 641
8 SASI_Hs01_00113264 predicted 2434
9 SASI_Hs01_00113265 predicted 804
10 SASI_Hs01_00113266 predicted 492
11 SASI_Hs01_00113258 predicted 2403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297591 predicted 2516
2 SASI_Mm02_00297592 predicted 819
3 SASI_Mm02_00297593 predicted 766
4 SASI_Mm02_00297594 predicted 2166
5 SASI_Mm02_00297595 predicted 196
6 SASI_Mm02_00297596 predicted 556
7 SASI_Mm02_00297597 predicted 2293
8 SASI_Mm02_00297598 predicted 873
9 SASI_Mm02_00297599 predicted 505
10 SASI_Mm02_00297600 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274558 predicted 2496
2 SASI_Mm01_00274559 predicted 2517
3 SASI_Mm01_00274560 predicted 829
4 SASI_Mm01_00274561 predicted 766
5 SASI_Mm01_00274562 predicted 2169
6 SASI_Mm01_00274563 predicted 206
7 SASI_Mm01_00274564 predicted 566
8 SASI_Mm01_00274565 predicted 504
9 SASI_Mm01_00274566 predicted 2294
10 SASI_Mm01_00274567 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005491
VALIDATED
MAMLD1 MISSION shRNA Bacterial Glycerol Stock
mastermind-like domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005491.1-861s1c1
Sequence:CCGGCCACCAGTAAGCAGATAGTGTCTCGAGACACTATCTGCTTACTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005491.1-1354s1c1
Sequence:CCGGCCTCATGTCCTCTACCATCAACTCGAGTTGATGGTAGAGGACATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-1989s1c1
Sequence:CCGGGCCATCTGTTTGCATGGACTTCTCGAGAAGTCCATGCAAACAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005491.1-1882s1c1
Sequence:CCGGGCCTGACCATTCTTCATTCCTCTCGAGAGGAATGAAGAATGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-466s1c1
Sequence:CCGGCCCTATGAATGGCAACATCATCTCGAGATGATGTTGCCATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-443s1c1
Sequence:CCGGCAGTCATTACTGCTGGAGAATCTCGAGATTCTCCAGCAGTAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005491.1-3585s1c1
Sequence:CCGGCGTTACAATTTGAGTGGTGTTCTCGAGAACACCACTCAAATTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-771s1c1
Sequence:CCGGGCAAGGAGTTTGCTTCTAGTTCTCGAGAACTAGAAGCAAACTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005491.2-3884s21c1
Sequence:CCGGCTAGGTGGCTGAGTCGCTTATCTCGAGATAAGCGACTCAGCCACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-403s21c1
Sequence:CCGGGGTCCCTCCATTGACAATAAACTCGAGTTTATTGTCAATGGAGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-2097s21c1
Sequence:CCGGACGTGTCACCGTCTAACATTACTCGAGTAATGTTAGACGGTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-2399s21c1
Sequence:CCGGTGAACGGCAGAATGCATATATCTCGAGATATATGCATTCTGCCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-2367s21c1
Sequence:CCGGGAACAGAGATCAGGTCTTATGCTCGAGCATAAGACCTGATCTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005491
VALIDATED
MAMLD1 MISSION shRNA shRNA Plasmid DNA
mastermind-like domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005491.1-861s1c1
Sequence:CCGGCCACCAGTAAGCAGATAGTGTCTCGAGACACTATCTGCTTACTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005491.1-1354s1c1
Sequence:CCGGCCTCATGTCCTCTACCATCAACTCGAGTTGATGGTAGAGGACATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-1989s1c1
Sequence:CCGGGCCATCTGTTTGCATGGACTTCTCGAGAAGTCCATGCAAACAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005491.1-1882s1c1
Sequence:CCGGGCCTGACCATTCTTCATTCCTCTCGAGAGGAATGAAGAATGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-466s1c1
Sequence:CCGGCCCTATGAATGGCAACATCATCTCGAGATGATGTTGCCATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-443s1c1
Sequence:CCGGCAGTCATTACTGCTGGAGAATCTCGAGATTCTCCAGCAGTAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005491.1-3585s1c1
Sequence:CCGGCGTTACAATTTGAGTGGTGTTCTCGAGAACACCACTCAAATTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-771s1c1
Sequence:CCGGGCAAGGAGTTTGCTTCTAGTTCTCGAGAACTAGAAGCAAACTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005491.2-3884s21c1
Sequence:CCGGCTAGGTGGCTGAGTCGCTTATCTCGAGATAAGCGACTCAGCCACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-403s21c1
Sequence:CCGGGGTCCCTCCATTGACAATAAACTCGAGTTTATTGTCAATGGAGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-2097s21c1
Sequence:CCGGACGTGTCACCGTCTAACATTACTCGAGTAATGTTAGACGGTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-2399s21c1
Sequence:CCGGTGAACGGCAGAATGCATATATCTCGAGATATATGCATTCTGCCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-2367s21c1
Sequence:CCGGGAACAGAGATCAGGTCTTATGCTCGAGCATAAGACCTGATCTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005491
VALIDATED
MAMLD1 MISSION shRNA Lentiviral Transduction Particles
mastermind-like domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005491.1-861s1c1
Sequence:CCGGCCACCAGTAAGCAGATAGTGTCTCGAGACACTATCTGCTTACTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005491.1-1354s1c1
Sequence:CCGGCCTCATGTCCTCTACCATCAACTCGAGTTGATGGTAGAGGACATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-1989s1c1
Sequence:CCGGGCCATCTGTTTGCATGGACTTCTCGAGAAGTCCATGCAAACAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005491.1-1882s1c1
Sequence:CCGGGCCTGACCATTCTTCATTCCTCTCGAGAGGAATGAAGAATGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-466s1c1
Sequence:CCGGCCCTATGAATGGCAACATCATCTCGAGATGATGTTGCCATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-443s1c1
Sequence:CCGGCAGTCATTACTGCTGGAGAATCTCGAGATTCTCCAGCAGTAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005491.1-3585s1c1
Sequence:CCGGCGTTACAATTTGAGTGGTGTTCTCGAGAACACCACTCAAATTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005491.1-771s1c1
Sequence:CCGGGCAAGGAGTTTGCTTCTAGTTCTCGAGAACTAGAAGCAAACTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005491.2-3884s21c1
Sequence:CCGGCTAGGTGGCTGAGTCGCTTATCTCGAGATAAGCGACTCAGCCACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-403s21c1
Sequence:CCGGGGTCCCTCCATTGACAATAAACTCGAGTTTATTGTCAATGGAGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-2097s21c1
Sequence:CCGGACGTGTCACCGTCTAACATTACTCGAGTAATGTTAGACGGTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-2399s21c1
Sequence:CCGGTGAACGGCAGAATGCATATATCTCGAGATATATGCATTCTGCCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005491.2-2367s21c1
Sequence:CCGGGAACAGAGATCAGGTCTTATGCTCGAGCATAAGACCTGATCTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081354
MAMLD1 MISSION shRNA Bacterial Glycerol Stock
mastermind-like domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-1063s21c1
Sequence:CCGGACAAGGTTCCAACCGCAATTGCTCGAGCAATTGCGGTTGGAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-449s21c1
Sequence:CCGGGGAGTGGCTGGCCAATCATTACTCGAGTAATGATTGGCCAGCCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-1240s21c1
Sequence:CCGGCTCGCCCAATGCCTTACTTTCCTCGAGGAAAGTAAGGCATTGGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081354.1-2950s21c1
Sequence:CCGGTAATAGAATTGTGCCGCATTTCTCGAGAAATGCGGCACAATTCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-305s21c1
Sequence:CCGGGCTGATGGGAGCTATCCTAATCTCGAGATTAGGATAGCTCCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081354
MAMLD1 MISSION shRNA shRNA Plasmid DNA
mastermind-like domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-1063s21c1
Sequence:CCGGACAAGGTTCCAACCGCAATTGCTCGAGCAATTGCGGTTGGAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-449s21c1
Sequence:CCGGGGAGTGGCTGGCCAATCATTACTCGAGTAATGATTGGCCAGCCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-1240s21c1
Sequence:CCGGCTCGCCCAATGCCTTACTTTCCTCGAGGAAAGTAAGGCATTGGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081354.1-2950s21c1
Sequence:CCGGTAATAGAATTGTGCCGCATTTCTCGAGAAATGCGGCACAATTCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-305s21c1
Sequence:CCGGGCTGATGGGAGCTATCCTAATCTCGAGATTAGGATAGCTCCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081354
MAMLD1 MISSION shRNA Lentiviral Transduction Particles
mastermind-like domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-1063s21c1
Sequence:CCGGACAAGGTTCCAACCGCAATTGCTCGAGCAATTGCGGTTGGAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-449s21c1
Sequence:CCGGGGAGTGGCTGGCCAATCATTACTCGAGTAATGATTGGCCAGCCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-1240s21c1
Sequence:CCGGCTCGCCCAATGCCTTACTTTCCTCGAGGAAAGTAAGGCATTGGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081354.1-2950s21c1
Sequence:CCGGTAATAGAATTGTGCCGCATTTCTCGAGAAATGCGGCACAATTCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081354.1-305s21c1
Sequence:CCGGGCTGATGGGAGCTATCCTAATCTCGAGATTAGGATAGCTCCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks