EMAIL THIS PAGE TO A FRIEND

MAN1B1

mannosidase, alpha, class 1B, member 1

Synonyms: ERMAN1 MANA-ER MRT15
UniProtKB ID: Q9UKM7, Q5VSG3, Q9BRS9, Q9Y5K7
Gene ID:
Human(11253) Summary: This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme functions in N-glycan biosynthesis, and is a class I alpha-1,2-mannosidase that specifically converts Man9GlcNAc to Man8GlcNAc isomer B. It is required for N-glycan trimming to Man5-6GlcNAc2 in the endoplasmic-reticulum-associated degradation pathway. Mutations in this gene cause autosomal-recessive intellectual disability. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Dec 2011]
Mouse(227619) mannosidase, alpha, class 1B, member 1
Rat(499751) mannosidase, alpha, class 1B, member 1
domestic guinea pig(100715996) mannosidase, alpha, class 1B, member 1
naked mole-rat(101724891) mannosidase, alpha, class 1B, member 1
Zebrafish(556237) mannosidase, alpha, class 1B, member 1
cow(100336900) mannosidase, alpha, class 1B, member 1
Horse(100147680) mannosidase, alpha, class 1B, member 1
dog(480667) mannosidase, alpha, class 1B, member 1
chicken(417296) mannosidase, alpha, class 1B, member 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1140 Kifunensine mannosidase inhibitor human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016219 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007230 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016219 Rosetta Predictions human pricing
XM_001077558 Rosetta Predictions rat pricing
XM_575086 Rosetta Predictions rat pricing
NM_001029983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349076 predicted 514
2 SASI_Hs01_00189358 predicted 1975
3 SASI_Hs01_00189359 predicted 501
4 SASI_Hs01_00189360 predicted 302
5 SASI_Hs01_00189361 predicted 1386
6 SASI_Hs01_00189362 predicted 467
7 SASI_Hs01_00189363 predicted 1730
8 SASI_Hs01_00189364 predicted 1147
9 SASI_Hs01_00189365 predicted 1146
10 SASI_Hs01_00189366 predicted 229
11 SASI_Hs01_00189367 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357558 predicted 1691
2 SASI_Rn02_00357559 predicted 1705
3 SASI_Rn02_00357560 predicted 1891
4 SASI_Rn02_00357561 predicted 964
5 SASI_Rn02_00357562 predicted 1299
6 SASI_Rn02_00357563 predicted 1458
7 SASI_Rn02_00357564 predicted 1838
8 SASI_Rn02_00357565 predicted 941
9 SASI_Rn02_00357566 predicted 586
10 SASI_Rn02_00357567 predicted 1793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403045 predicted 1683
2 SASI_Rn02_00403046 predicted 1708
3 SASI_Rn02_00403047 predicted 1890
4 SASI_Rn02_00403048 predicted 965
5 SASI_Rn02_00403049 predicted 1302
6 SASI_Rn02_00403050 predicted 1457
7 SASI_Rn02_00403051 predicted 1843
8 SASI_Rn02_00403052 predicted 938
9 SASI_Rn02_00403053 predicted 586
10 SASI_Rn02_00403054 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034964 predicted 1678
2 SASI_Mm01_00034965 predicted 1789
3 SASI_Mm01_00034966 predicted 1890
4 SASI_Mm01_00034967 predicted 379
5 SASI_Mm02_00288084 predicted 921
6 SASI_Mm01_00034968 predicted 883
7 SASI_Mm01_00034969 predicted 1291
8 SASI_Mm01_00034970 predicted 227
9 SASI_Mm01_00034971 predicted 1837
10 SASI_Mm01_00034972 predicted 1101
11 SASI_Mm01_00034973 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029983
VALIDATED
MAN1B1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 1B, member 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-969s21c1
Sequence:CCGGGAGAGCACCATTCGCATCTTACTCGAGTAAGATGCGAATGGTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-1682s21c1
Sequence:CCGGGAGCCCTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-1364s21c1
Sequence:CCGGGGCTGACAGCTACTACGAATACTCGAGTATTCGTAGTAGCTGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-3024s1c1
Sequence:CCGGTAGGATTCTCCTATCCAATTCCTCGAGGAATTGGATAGGAGAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029983.1-2384s21c1
Sequence:CCGGGGTAGTCCCAAGACTTCTTATCTCGAGATAAGAAGTCTTGGGACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-1709s21c1
Sequence:CCGGGTACCCTCGGGCAGATCATAACTCGAGTTATGATCTGCCCGAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-351s1c1
Sequence:CCGGGAAGTAGAGAAGATGAAGCAACTCGAGTTGCTTCATCTTCTCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029983.1-1778s1c1
Sequence:CCGGGACGGTGGAAAGCCTATTCTACTCGAGTAGAATAGGCTTTCCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029983.1-969s1c1
Sequence:CCGGGAGAGCACCATTCGCATCTTACTCGAGTAAGATGCGAATGGTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029983.1-3298s1c1
Sequence:CCGGGCCTTGAGTTTATGGGTAGAACTCGAGTTCTACCCATAAACTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029983.1-1034s1c1
Sequence:CCGGCCTGACCAAAGCTGAAGATTTCTCGAGAAATCTTCAGCTTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-1682s1c1
Sequence:CCGGGAGCCCTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029983.1-664s1c1
Sequence:CCGGCCTCCATCAAACCTCTGGTTTCTCGAGAAACCAGAGGTTTGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029983.1-2980s1c1
Sequence:CCGGCCTGTCTTTGATGAGTTGTTACTCGAGTAACAACTCATCAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-1098s1c1
Sequence:CCGGCCATACTCTGATGTGAACATTCTCGAGAATGTTCACATCAGAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029983
VALIDATED
MAN1B1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 1B, member 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-969s21c1
Sequence:CCGGGAGAGCACCATTCGCATCTTACTCGAGTAAGATGCGAATGGTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-1682s21c1
Sequence:CCGGGAGCCCTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-1364s21c1
Sequence:CCGGGGCTGACAGCTACTACGAATACTCGAGTATTCGTAGTAGCTGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-3024s1c1
Sequence:CCGGTAGGATTCTCCTATCCAATTCCTCGAGGAATTGGATAGGAGAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029983.1-2384s21c1
Sequence:CCGGGGTAGTCCCAAGACTTCTTATCTCGAGATAAGAAGTCTTGGGACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-1709s21c1
Sequence:CCGGGTACCCTCGGGCAGATCATAACTCGAGTTATGATCTGCCCGAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-351s1c1
Sequence:CCGGGAAGTAGAGAAGATGAAGCAACTCGAGTTGCTTCATCTTCTCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029983.1-1778s1c1
Sequence:CCGGGACGGTGGAAAGCCTATTCTACTCGAGTAGAATAGGCTTTCCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029983.1-969s1c1
Sequence:CCGGGAGAGCACCATTCGCATCTTACTCGAGTAAGATGCGAATGGTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029983.1-3298s1c1
Sequence:CCGGGCCTTGAGTTTATGGGTAGAACTCGAGTTCTACCCATAAACTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029983.1-1034s1c1
Sequence:CCGGCCTGACCAAAGCTGAAGATTTCTCGAGAAATCTTCAGCTTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-1682s1c1
Sequence:CCGGGAGCCCTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029983.1-664s1c1
Sequence:CCGGCCTCCATCAAACCTCTGGTTTCTCGAGAAACCAGAGGTTTGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029983.1-2980s1c1
Sequence:CCGGCCTGTCTTTGATGAGTTGTTACTCGAGTAACAACTCATCAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-1098s1c1
Sequence:CCGGCCATACTCTGATGTGAACATTCTCGAGAATGTTCACATCAGAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029983
VALIDATED
MAN1B1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 1B, member 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-969s21c1
Sequence:CCGGGAGAGCACCATTCGCATCTTACTCGAGTAAGATGCGAATGGTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-1682s21c1
Sequence:CCGGGAGCCCTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-1364s21c1
Sequence:CCGGGGCTGACAGCTACTACGAATACTCGAGTATTCGTAGTAGCTGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-3024s1c1
Sequence:CCGGTAGGATTCTCCTATCCAATTCCTCGAGGAATTGGATAGGAGAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029983.1-2384s21c1
Sequence:CCGGGGTAGTCCCAAGACTTCTTATCTCGAGATAAGAAGTCTTGGGACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029983.1-1709s21c1
Sequence:CCGGGTACCCTCGGGCAGATCATAACTCGAGTTATGATCTGCCCGAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-351s1c1
Sequence:CCGGGAAGTAGAGAAGATGAAGCAACTCGAGTTGCTTCATCTTCTCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029983.1-1778s1c1
Sequence:CCGGGACGGTGGAAAGCCTATTCTACTCGAGTAGAATAGGCTTTCCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029983.1-969s1c1
Sequence:CCGGGAGAGCACCATTCGCATCTTACTCGAGTAAGATGCGAATGGTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029983.1-3298s1c1
Sequence:CCGGGCCTTGAGTTTATGGGTAGAACTCGAGTTCTACCCATAAACTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029983.1-1034s1c1
Sequence:CCGGCCTGACCAAAGCTGAAGATTTCTCGAGAAATCTTCAGCTTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-1682s1c1
Sequence:CCGGGAGCCCTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029983.1-664s1c1
Sequence:CCGGCCTCCATCAAACCTCTGGTTTCTCGAGAAACCAGAGGTTTGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029983.1-2980s1c1
Sequence:CCGGCCTGTCTTTGATGAGTTGTTACTCGAGTAACAACTCATCAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001029983.1-1098s1c1
Sequence:CCGGCCATACTCTGATGTGAACATTCTCGAGAATGTTCACATCAGAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016219
MAN1B1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 1B, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000220066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016219.2-2416s1c1
Sequence:CCGGACGAATCATGACTCACGATTGCTCGAGCAATCGTGAGTCATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016219.2-1783s1c1
Sequence:CCGGGATCGTGCACTTCAACCTTTACTCGAGTAAAGGTTGAAGTGCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016219.2-564s1c1
Sequence:CCGGGACCACCTCACCTGCAGATTACTCGAGTAATCTGCAGGTGAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016219
MAN1B1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 1B, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000220066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016219.2-2416s1c1
Sequence:CCGGACGAATCATGACTCACGATTGCTCGAGCAATCGTGAGTCATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016219.2-1783s1c1
Sequence:CCGGGATCGTGCACTTCAACCTTTACTCGAGTAAAGGTTGAAGTGCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016219.2-564s1c1
Sequence:CCGGGACCACCTCACCTGCAGATTACTCGAGTAATCTGCAGGTGAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016219
MAN1B1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 1B, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000220066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016219.2-2416s1c1
Sequence:CCGGACGAATCATGACTCACGATTGCTCGAGCAATCGTGAGTCATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016219.2-1783s1c1
Sequence:CCGGGATCGTGCACTTCAACCTTTACTCGAGTAAAGGTTGAAGTGCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016219.2-564s1c1
Sequence:CCGGGACCACCTCACCTGCAGATTACTCGAGTAATCTGCAGGTGAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007230
VALIDATED
MAN1B1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 1B, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007230.1-934s1c1
Sequence:CCGGCGAAGAAGTTACACTTTGAAACTCGAGTTTCAAAGTGTAACTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007230.1-356s1c1
Sequence:CCGGGCCAGAAATTGCTGGGTTAAACTCGAGTTTAACCCAGCAATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007230.1-2219s1c1
Sequence:CCGGCCTCCTCGTCTCTGCTTTAATCTCGAGATTAAAGCAGAGACGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007230.1-1646s1c1
Sequence:CCGGCATGGAGACTTGTTACCAGATCTCGAGATCTGGTAACAAGTCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007230.1-233s1c1
Sequence:CCGGGCAGCGGAATATGATTCTCTTCTCGAGAAGAGAATCATATTCCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007230.1-426s1c1
Sequence:CCGGCCTGAGAACTTACCTGAGATTCTCGAGAATCTCAGGTAAGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007230.1-1982s1c1
Sequence:CCGGGCTCAAGTATCTGTTCTTGCTCTCGAGAGCAAGAACAGATACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007230
VALIDATED
MAN1B1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 1B, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007230.1-934s1c1
Sequence:CCGGCGAAGAAGTTACACTTTGAAACTCGAGTTTCAAAGTGTAACTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007230.1-356s1c1
Sequence:CCGGGCCAGAAATTGCTGGGTTAAACTCGAGTTTAACCCAGCAATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007230.1-2219s1c1
Sequence:CCGGCCTCCTCGTCTCTGCTTTAATCTCGAGATTAAAGCAGAGACGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007230.1-1646s1c1
Sequence:CCGGCATGGAGACTTGTTACCAGATCTCGAGATCTGGTAACAAGTCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007230.1-233s1c1
Sequence:CCGGGCAGCGGAATATGATTCTCTTCTCGAGAAGAGAATCATATTCCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007230.1-426s1c1
Sequence:CCGGCCTGAGAACTTACCTGAGATTCTCGAGAATCTCAGGTAAGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007230.1-1982s1c1
Sequence:CCGGGCTCAAGTATCTGTTCTTGCTCTCGAGAGCAAGAACAGATACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007230
VALIDATED
MAN1B1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 1B, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007230.1-934s1c1
Sequence:CCGGCGAAGAAGTTACACTTTGAAACTCGAGTTTCAAAGTGTAACTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007230.1-356s1c1
Sequence:CCGGGCCAGAAATTGCTGGGTTAAACTCGAGTTTAACCCAGCAATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007230.1-2219s1c1
Sequence:CCGGCCTCCTCGTCTCTGCTTTAATCTCGAGATTAAAGCAGAGACGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007230.1-1646s1c1
Sequence:CCGGCATGGAGACTTGTTACCAGATCTCGAGATCTGGTAACAAGTCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007230.1-233s1c1
Sequence:CCGGGCAGCGGAATATGATTCTCTTCTCGAGAAGAGAATCATATTCCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007230.1-426s1c1
Sequence:CCGGCCTGAGAACTTACCTGAGATTCTCGAGAATCTCAGGTAAGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007230.1-1982s1c1
Sequence:CCGGGCTCAAGTATCTGTTCTTGCTCTCGAGAGCAAGAACAGATACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks