EMAIL THIS PAGE TO A FRIEND

MANBAL

mannosidase, beta A, lysosomal-like

UniProtKB ID: Q9NQG1, A8KAA6, E1P5V3
Gene ID:
Mouse(69161) mannosidase, beta A, lysosomal-like
Rat(499934) mannosidase, beta A, lysosomal-like
sheep(101102831) mannosidase, beta A, lysosomal-like
domestic guinea pig(100728224) mannosidase, beta A, lysosomal-like
naked mole-rat(101704904) mannosidase, beta A, lysosomal-like
chicken(428138) mannosidase, beta A, lysosomal-like
cow(787482) mannosidase, beta A, lysosomal-like
domestic cat(101100800) mannosidase, beta A, lysosomal-like
dog(610351) mannosidase, beta A, lysosomal-like
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003897 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054341 MISSION® esiRNA esiRNA human MANBAL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003897 Rosetta Predictions human pricing
NM_022077 Rosetta Predictions human pricing
XM_001067976 Rosetta Predictions rat pricing
XM_575279 Rosetta Predictions rat pricing
NM_026968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099206 predicted 579
2 SASI_Hs01_00099207 predicted 578
3 SASI_Hs01_00099208 predicted 847
4 SASI_Hs01_00099209 predicted 764
5 SASI_Hs01_00099210 predicted 737
6 SASI_Hs01_00099211 predicted 478
7 SASI_Hs01_00099212 predicted 464
8 SASI_Hs01_00099213 predicted 648
9 SASI_Hs01_00099214 predicted 332
10 SASI_Hs01_00099215 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150078 predicted 696
2 SASI_Hs01_00150079 predicted 687
3 SASI_Hs01_00150080 predicted 962
4 SASI_Hs01_00150081 predicted 887
5 SASI_Hs01_00150082 predicted 862
6 SASI_Hs01_00150083 predicted 593
7 SASI_Hs01_00150084 predicted 586
8 SASI_Hs01_00150085 predicted 766
9 SASI_Hs01_00150086 predicted 452
10 SASI_Hs01_00150087 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323016 predicted 643
2 SASI_Rn02_00323017 predicted 598
3 SASI_Rn02_00323018 predicted 305
4 SASI_Rn02_00323019 predicted 476
5 SASI_Rn02_00323020 predicted 644
6 SASI_Rn02_00323021 predicted 619
7 SASI_Rn02_00323022 predicted 562
8 SASI_Rn02_00323023 predicted 527
9 SASI_Rn02_00323024 predicted 572
10 SASI_Rn02_00323025 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403450 predicted 1122
2 SASI_Rn02_00403451 predicted 1069
3 SASI_Rn02_00403452 predicted 789
4 SASI_Rn02_00403453 predicted 954
5 SASI_Rn02_00403454 predicted 1117
6 SASI_Rn02_00403455 predicted 1105
7 SASI_Rn02_00403456 predicted 1047
8 SASI_Rn02_00403457 predicted 1001
9 SASI_Rn02_00403458 predicted 1055
10 SASI_Rn02_00403459 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075272 predicted 436
2 SASI_Mm01_00075274 predicted 453
3 SASI_Mm01_00075276 predicted 443
4 SASI_Mm02_00331289 predicted 443
5 SASI_Mm01_00075271 predicted 326
6 SASI_Mm01_00075273 predicted 501
7 SASI_Mm01_00075275 predicted 474
8 SASI_Mm02_00331290 predicted 456
9 SASI_Mm01_00075277 predicted 293
10 SASI_Mm01_00075278 predicted 232
11 SASI_Mm01_00075279 predicted 466
12 SASI_Mm01_00075280 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003897
VALIDATED
MANBAL MISSION shRNA Bacterial Glycerol Stock
mannosidase, beta A, lysosomal-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003897.1-763s21c1
Sequence:CCGGCAGATCTCCTCCTGATCAGTCCTCGAGGACTGATCAGGAGGAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003897.1-481s21c1
Sequence:CCGGAGAGATCTAGACAGTCGTAACCTCGAGGTTACGACTGTCTAGATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003897.1-588s21c1
Sequence:CCGGTGTGAGCATAGACTGTATTAGCTCGAGCTAATACAGTCTATGCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003897.1-408s1c1
Sequence:CCGGCCTGGGAATCTACATTGTGTTCTCGAGAACACAATGTAGATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003897.1-134s1c1
Sequence:CCGGCGAGCCCACTTTCCTGGAGAACTCGAGTTCTCCAGGAAAGTGGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003897.1-332s1c1
Sequence:CCGGAGAGACTAAGAAGAAGCGGTACTCGAGTACCGCTTCTTCTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003897.1-299s1c1
Sequence:CCGGTGCTGTTCCTTCTGTGAACAACTCGAGTTGTTCACAGAAGGAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003897.1-323s1c1
Sequence:CCGGGCCCAAGAAAGAGACTAAGAACTCGAGTTCTTAGTCTCTTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003897
VALIDATED
MANBAL MISSION shRNA shRNA Plasmid DNA
mannosidase, beta A, lysosomal-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003897.1-763s21c1
Sequence:CCGGCAGATCTCCTCCTGATCAGTCCTCGAGGACTGATCAGGAGGAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003897.1-481s21c1
Sequence:CCGGAGAGATCTAGACAGTCGTAACCTCGAGGTTACGACTGTCTAGATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003897.1-588s21c1
Sequence:CCGGTGTGAGCATAGACTGTATTAGCTCGAGCTAATACAGTCTATGCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003897.1-408s1c1
Sequence:CCGGCCTGGGAATCTACATTGTGTTCTCGAGAACACAATGTAGATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003897.1-134s1c1
Sequence:CCGGCGAGCCCACTTTCCTGGAGAACTCGAGTTCTCCAGGAAAGTGGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003897.1-332s1c1
Sequence:CCGGAGAGACTAAGAAGAAGCGGTACTCGAGTACCGCTTCTTCTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003897.1-299s1c1
Sequence:CCGGTGCTGTTCCTTCTGTGAACAACTCGAGTTGTTCACAGAAGGAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003897.1-323s1c1
Sequence:CCGGGCCCAAGAAAGAGACTAAGAACTCGAGTTCTTAGTCTCTTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003897
VALIDATED
MANBAL MISSION shRNA Lentiviral Transduction Particles
mannosidase, beta A, lysosomal-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003897.1-763s21c1
Sequence:CCGGCAGATCTCCTCCTGATCAGTCCTCGAGGACTGATCAGGAGGAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003897.1-481s21c1
Sequence:CCGGAGAGATCTAGACAGTCGTAACCTCGAGGTTACGACTGTCTAGATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003897.1-588s21c1
Sequence:CCGGTGTGAGCATAGACTGTATTAGCTCGAGCTAATACAGTCTATGCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003897.1-408s1c1
Sequence:CCGGCCTGGGAATCTACATTGTGTTCTCGAGAACACAATGTAGATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003897.1-134s1c1
Sequence:CCGGCGAGCCCACTTTCCTGGAGAACTCGAGTTCTCCAGGAAAGTGGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003897.1-332s1c1
Sequence:CCGGAGAGACTAAGAAGAAGCGGTACTCGAGTACCGCTTCTTCTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003897.1-299s1c1
Sequence:CCGGTGCTGTTCCTTCTGTGAACAACTCGAGTTGTTCACAGAAGGAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003897.1-323s1c1
Sequence:CCGGGCCCAAGAAAGAGACTAAGAACTCGAGTTCTTAGTCTCTTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026968
VALIDATED
MANBAL MISSION shRNA Bacterial Glycerol Stock
mannosidase, beta A, lysosomal-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-192s21c1
Sequence:CCGGTGGCCATCATCGTACCCATTCCTCGAGGAATGGGTACGATGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-319s21c1
Sequence:CCGGGACGAAGAAGAAGCGATAGAACTCGAGTTCTATCGCTTCTTCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-295s21c1
Sequence:CCGGCACCAACAAGAGGCCGAAGAACTCGAGTTCTTCGGCCTCTTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-657s21c1
Sequence:CCGGCTCACTAACAGCATGGAATTGCTCGAGCAATTCCATGCTGTTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-154s21c1
Sequence:CCGGACTCTTCCTGGGAGCCATCTTCTCGAGAAGATGGCTCCCAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026968.1-514s1c1
Sequence:CCGGGACCACCACTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAGTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026968.1-311s1c1
Sequence:CCGGGAAGAAGGAGACGAAGAAGAACTCGAGTTCTTCTTCGTCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194516    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026968.1-457s1c1
Sequence:CCGGGATTGAAACTCCCTCTGACTACTCGAGTAGTCAGAGGGAGTTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026968
VALIDATED
MANBAL MISSION shRNA shRNA Plasmid DNA
mannosidase, beta A, lysosomal-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-192s21c1
Sequence:CCGGTGGCCATCATCGTACCCATTCCTCGAGGAATGGGTACGATGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-319s21c1
Sequence:CCGGGACGAAGAAGAAGCGATAGAACTCGAGTTCTATCGCTTCTTCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-295s21c1
Sequence:CCGGCACCAACAAGAGGCCGAAGAACTCGAGTTCTTCGGCCTCTTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-657s21c1
Sequence:CCGGCTCACTAACAGCATGGAATTGCTCGAGCAATTCCATGCTGTTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-154s21c1
Sequence:CCGGACTCTTCCTGGGAGCCATCTTCTCGAGAAGATGGCTCCCAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026968.1-514s1c1
Sequence:CCGGGACCACCACTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAGTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026968.1-311s1c1
Sequence:CCGGGAAGAAGGAGACGAAGAAGAACTCGAGTTCTTCTTCGTCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194516    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026968.1-457s1c1
Sequence:CCGGGATTGAAACTCCCTCTGACTACTCGAGTAGTCAGAGGGAGTTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026968
VALIDATED
MANBAL MISSION shRNA Lentiviral Transduction Particles
mannosidase, beta A, lysosomal-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-192s21c1
Sequence:CCGGTGGCCATCATCGTACCCATTCCTCGAGGAATGGGTACGATGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-319s21c1
Sequence:CCGGGACGAAGAAGAAGCGATAGAACTCGAGTTCTATCGCTTCTTCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-295s21c1
Sequence:CCGGCACCAACAAGAGGCCGAAGAACTCGAGTTCTTCGGCCTCTTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-657s21c1
Sequence:CCGGCTCACTAACAGCATGGAATTGCTCGAGCAATTCCATGCTGTTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026968.2-154s21c1
Sequence:CCGGACTCTTCCTGGGAGCCATCTTCTCGAGAAGATGGCTCCCAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026968.1-514s1c1
Sequence:CCGGGACCACCACTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAGTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026968.1-311s1c1
Sequence:CCGGGAAGAAGGAGACGAAGAAGAACTCGAGTTCTTCTTCGTCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194516    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026968.1-457s1c1
Sequence:CCGGGATTGAAACTCCCTCTGACTACTCGAGTAGTCAGAGGGAGTTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks