EMAIL THIS PAGE TO A FRIEND

MAP10

microtubule-associated protein 10

Synonyms: KIAA1383 MTR120
UniProtKB ID: Q9P2G4, A8K2F1, Q32MI1, Q58EZ9, Q5VV83
Gene ID:
Mouse(74393) microtubule-associated protein 10
Rat(307948) microtubule-associated protein 10
domestic guinea pig(100727695) microtubule-associated protein 10
naked mole-rat(101706774) microtubule-associated protein 10
chicken(101666873) microtubule-associated protein 10
cow(781199) KIAA1383 ortholog
chicken(101747480) microtubule-associated protein 10
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA052496 Anti-MAP10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019090 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU036951 MISSION® esiRNA esiRNA targeting mouse 4933403G14Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019090 Rosetta Predictions human pricing
XM_378184 Rosetta Predictions human pricing
XM_001055474 Rosetta Predictions rat pricing
XM_001079502 Rosetta Predictions rat pricing
NM_028908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352691 predicted 2090
2 SASI_Hs02_00352692 predicted 2582
3 SASI_Hs02_00352693 predicted 1761
4 SASI_Hs02_00352694 predicted 1316
5 SASI_Hs02_00352695 predicted 1786
6 SASI_Hs02_00352696 predicted 2596
7 SASI_Hs02_00352697 predicted 1719
8 SASI_Hs02_00352698 predicted 2053
9 SASI_Hs02_00352699 predicted 3153
10 SASI_Hs02_00352700 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_378184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280782 predicted 2527
2 SASI_Hs01_00280783 predicted 2197
3 SASI_Hs01_00280784 predicted 1762
4 SASI_Hs01_00280785 predicted 2235
5 SASI_Hs01_00280786 predicted 3033
6 SASI_Hs01_00280787 predicted 2160
7 SASI_Hs01_00280788 predicted 2500
8 SASI_Hs01_00280789 predicted 3597
9 SASI_Hs01_00280790 predicted 2092
10 SASI_Hs01_00280791 predicted 2164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279661 predicted 987
2 SASI_Rn02_00279662 predicted 1149
3 SASI_Rn02_00279663 predicted 1347
4 SASI_Rn02_00279664 predicted 284
5 SASI_Rn02_00279665 predicted 909
6 SASI_Rn02_00279666 predicted 1152
7 SASI_Rn02_00279667 predicted 1131
8 SASI_Rn02_00279668 predicted 1182
9 SASI_Rn02_00279669 predicted 1062
10 SASI_Rn02_00279670 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364536 predicted 995
2 SASI_Rn02_00364537 predicted 1157
3 SASI_Rn02_00364538 predicted 1346
4 SASI_Rn02_00364539 predicted 282
5 SASI_Rn02_00364540 predicted 914
6 SASI_Rn02_00364541 predicted 1150
7 SASI_Rn02_00364542 predicted 1133
8 SASI_Rn02_00364543 predicted 1183
9 SASI_Rn02_00364544 predicted 1062
10 SASI_Rn02_00364545 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038102 predicted 2715
2 SASI_Mm02_00334591 predicted 944
3 SASI_Mm01_00038104 predicted 1377
4 SASI_Mm01_00038105 predicted 1853
5 SASI_Mm01_00038106 predicted 2750
6 SASI_Mm01_00038107 predicted 1083
7 SASI_Mm01_00038108 predicted 2555
8 SASI_Mm01_00038109 predicted 1682
9 SASI_Mm01_00038110 predicted 2623
10 SASI_Mm01_00038111 predicted 937
11 SASI_Mm01_00038103 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028908
MAP10 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-2673s21c1
Sequence:CCGGCAGTGTGAAAGTATGCTATTTCTCGAGAAATAGCATACTTTCACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028908.2-2814s21c1
Sequence:CCGGTTACCCTACAAACTGATTATACTCGAGTATAATCAGTTTGTAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-2632s21c1
Sequence:CCGGAGACATCTGCGAGTTAGTAATCTCGAGATTACTAACTCGCAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-1398s21c1
Sequence:CCGGATACACTGAGACTGCGTTTACCTCGAGGTAAACGCAGTCTCAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-1856s21c1
Sequence:CCGGGAAAGATCTCTTCGATCAAATCTCGAGATTTGATCGAAGAGATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028908.1-2438s1c1
Sequence:CCGGGCTCCACTAAACTTAAAGTAACTCGAGTTACTTTAAGTTTAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028908.1-2980s1c1
Sequence:CCGGGCTAATAAGTTTAGCACCAATCTCGAGATTGGTGCTAAACTTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028908.1-2947s1c1
Sequence:CCGGGCATTTCATGTACCATTGTAACTCGAGTTACAATGGTACATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028908
MAP10 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-2673s21c1
Sequence:CCGGCAGTGTGAAAGTATGCTATTTCTCGAGAAATAGCATACTTTCACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028908.2-2814s21c1
Sequence:CCGGTTACCCTACAAACTGATTATACTCGAGTATAATCAGTTTGTAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-2632s21c1
Sequence:CCGGAGACATCTGCGAGTTAGTAATCTCGAGATTACTAACTCGCAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-1398s21c1
Sequence:CCGGATACACTGAGACTGCGTTTACCTCGAGGTAAACGCAGTCTCAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-1856s21c1
Sequence:CCGGGAAAGATCTCTTCGATCAAATCTCGAGATTTGATCGAAGAGATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028908.1-2438s1c1
Sequence:CCGGGCTCCACTAAACTTAAAGTAACTCGAGTTACTTTAAGTTTAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028908.1-2980s1c1
Sequence:CCGGGCTAATAAGTTTAGCACCAATCTCGAGATTGGTGCTAAACTTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028908.1-2947s1c1
Sequence:CCGGGCATTTCATGTACCATTGTAACTCGAGTTACAATGGTACATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028908
MAP10 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-2673s21c1
Sequence:CCGGCAGTGTGAAAGTATGCTATTTCTCGAGAAATAGCATACTTTCACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028908.2-2814s21c1
Sequence:CCGGTTACCCTACAAACTGATTATACTCGAGTATAATCAGTTTGTAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-2632s21c1
Sequence:CCGGAGACATCTGCGAGTTAGTAATCTCGAGATTACTAACTCGCAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-1398s21c1
Sequence:CCGGATACACTGAGACTGCGTTTACCTCGAGGTAAACGCAGTCTCAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028908.2-1856s21c1
Sequence:CCGGGAAAGATCTCTTCGATCAAATCTCGAGATTTGATCGAAGAGATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028908.1-2438s1c1
Sequence:CCGGGCTCCACTAAACTTAAAGTAACTCGAGTTACTTTAAGTTTAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028908.1-2980s1c1
Sequence:CCGGGCTAATAAGTTTAGCACCAATCTCGAGATTGGTGCTAAACTTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028908.1-2947s1c1
Sequence:CCGGGCATTTCATGTACCATTGTAACTCGAGTTACAATGGTACATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019090
MAP10 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-441s21c1
Sequence:CCGGTCCGCAAATCTCGCGAGATAGCTCGAGCTATCTCGCGAGATTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-1433s21c1
Sequence:CCGGTGGACATGGAGACCAATATATCTCGAGATATATTGGTCTCCATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019090.2-4557s21c1
Sequence:CCGGATGGGAATGAGCCTGATATATCTCGAGATATATCAGGCTCATTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-1820s21c1
Sequence:CCGGCTCACCTAGCCTGGTTATATACTCGAGTATATAACCAGGCTAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-2061s21c1
Sequence:CCGGTACACTAAGACTACGTTTAAACTCGAGTTTAAACGTAGTCTTAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019090
MAP10 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-441s21c1
Sequence:CCGGTCCGCAAATCTCGCGAGATAGCTCGAGCTATCTCGCGAGATTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-1433s21c1
Sequence:CCGGTGGACATGGAGACCAATATATCTCGAGATATATTGGTCTCCATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019090.2-4557s21c1
Sequence:CCGGATGGGAATGAGCCTGATATATCTCGAGATATATCAGGCTCATTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-1820s21c1
Sequence:CCGGCTCACCTAGCCTGGTTATATACTCGAGTATATAACCAGGCTAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-2061s21c1
Sequence:CCGGTACACTAAGACTACGTTTAAACTCGAGTTTAAACGTAGTCTTAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019090
MAP10 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-441s21c1
Sequence:CCGGTCCGCAAATCTCGCGAGATAGCTCGAGCTATCTCGCGAGATTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-1433s21c1
Sequence:CCGGTGGACATGGAGACCAATATATCTCGAGATATATTGGTCTCCATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019090.2-4557s21c1
Sequence:CCGGATGGGAATGAGCCTGATATATCTCGAGATATATCAGGCTCATTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-1820s21c1
Sequence:CCGGCTCACCTAGCCTGGTTATATACTCGAGTATATAACCAGGCTAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019090.2-2061s21c1
Sequence:CCGGTACACTAAGACTACGTTTAAACTCGAGTTTAAACGTAGTCTTAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks