EMAIL THIS PAGE TO A FRIEND

MAP3K15

mitogen-activated protein kinase kinase kinase 15

Synonyms: ASK3 bA723P2.3
UniProtKB ID: Q6ZN16, A2AI49, A2AI50, A6NJ61, Q5JPR4, Q6ZMV3
Gene ID:
Human(389840) Summary: The protein encoded by this gene is a member of the mitogen-activated protein kinase (MAPK) family. These family members function in a protein kinase signal transduction cascade, where an activated MAPK kinase kinase (MAP3K) phosphorylates and activates a specific MAPK kinase (MAP2K), which then activates a specific MAPK. This MAP3K protein plays an essential role in apoptotic cell death triggered by cellular stresses. [provided by RefSeq, Jul 2010]
Mouse(270672) mitogen-activated protein kinase kinase kinase 15
Rat(501558) mitogen-activated protein kinase kinase kinase 15
chicken(418609) mitogen-activated protein kinase kinase kinase 15
cow(529335) mitogen-activated protein kinase kinase kinase 15
Horse(100058434) mitogen-activated protein kinase kinase kinase 15
domestic cat(101089836) mitogen-activated protein kinase kinase kinase 15
dog(491765) mitogen-activated protein kinase kinase kinase 15
sheep(101104888) mitogen-activated protein kinase kinase kinase 15
domestic guinea pig(100720130) mitogen-activated protein kinase kinase kinase 15
naked mole-rat(101702514) mitogen-activated protein kinase kinase kinase 15
Domestic Rabbit(100357608) mitogen-activated protein kinase kinase kinase 15
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372199 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001671 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_486812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001671 Rosetta Predictions human pricing
XM_001054480 Rosetta Predictions rat pricing
XM_576963 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185702 predicted 2812
2 SASI_Hs02_00303868 predicted 2207
3 SASI_Hs01_00185703 predicted 3851
4 SASI_Hs01_00185705 predicted 3866
5 SASI_Hs02_00303869 predicted 2681
6 SASI_Hs01_00185707 predicted 2162
7 SASI_Hs01_00185706 predicted 2443
8 SASI_Hs01_00185708 predicted 3879
9 SASI_Hs01_00185709 predicted 3293
10 SASI_Hs01_00185710 predicted 3839
11 SASI_Hs01_00185704 predicted 3819
12 SASI_Hs01_00185711 predicted 3338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275938 predicted 1247
2 SASI_Rn02_00275939 predicted 1512
3 SASI_Rn02_00275940 predicted 4410
4 SASI_Rn02_00275941 predicted 726
5 SASI_Rn02_00275942 predicted 1685
6 SASI_Rn02_00275943 predicted 4015
7 SASI_Rn02_00275944 predicted 1558
8 SASI_Rn02_00275945 predicted 538
9 SASI_Rn02_00275946 predicted 963
10 SASI_Rn02_00275947 predicted 3616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406008 predicted 531
2 SASI_Rn02_00406009 predicted 463
3 SASI_Rn02_00406010 predicted 537
4 SASI_Rn02_00406011 predicted 581
5 SASI_Rn02_00406012 predicted 517
6 SASI_Rn02_00406013 predicted 209
7 SASI_Rn02_00406014 predicted 294
8 SASI_Rn02_00406015 predicted 643
9 SASI_Rn02_00406016 predicted 420
10 SASI_Rn02_00406017 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372199
MAP3K15 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 15
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000021404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_372199.2-3708s1c1
Sequence:CCGGCCGCTGTGTTTACATATTTAACTCGAGTTAAATATGTAAACACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372199.2-1800s1c1
Sequence:CCGGGCACCGCAATATCGTTCAGTACTCGAGTACTGAACGATATTGCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372199.2-1098s1c1
Sequence:CCGGCCTGCGATCATTAGTTCAGAACTCGAGTTCTGAACTAATGATCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372199.2-472s1c1
Sequence:CCGGCGCATGGATAATACTGAGGTTCTCGAGAACCTCAGTATTATCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372199
MAP3K15 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 15
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000021404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_372199.2-3708s1c1
Sequence:CCGGCCGCTGTGTTTACATATTTAACTCGAGTTAAATATGTAAACACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372199.2-1800s1c1
Sequence:CCGGGCACCGCAATATCGTTCAGTACTCGAGTACTGAACGATATTGCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372199.2-1098s1c1
Sequence:CCGGCCTGCGATCATTAGTTCAGAACTCGAGTTCTGAACTAATGATCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372199.2-472s1c1
Sequence:CCGGCGCATGGATAATACTGAGGTTCTCGAGAACCTCAGTATTATCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372199
MAP3K15 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 15
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000021404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_372199.2-3708s1c1
Sequence:CCGGCCGCTGTGTTTACATATTTAACTCGAGTTAAATATGTAAACACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372199.2-1800s1c1
Sequence:CCGGGCACCGCAATATCGTTCAGTACTCGAGTACTGAACGATATTGCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372199.2-1098s1c1
Sequence:CCGGCCTGCGATCATTAGTTCAGAACTCGAGTTCTGAACTAATGATCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372199.2-472s1c1
Sequence:CCGGCGCATGGATAATACTGAGGTTCTCGAGAACCTCAGTATTATCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001671
MAP3K15 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001671.1-3341s1c1
Sequence:CCGGGATTTCAGGATGCCGTAAATACTCGAGTATTTACGGCATCCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001671.1-4462s1c1
Sequence:CCGGCCTCAGAACTGGTATGGTACTCTCGAGAGTACCATACCAGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001671.1-1809s1c1
Sequence:CCGGCCTATCAAAGTTTGATGAAAGCTCGAGCTTTCATCAAACTTTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001671.1-4509s1c1
Sequence:CCGGCGAATGTGCCTTGTAGTTAATCTCGAGATTAACTACAAGGCACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001671.1-3854s1c1
Sequence:CCGGGTTATACACTTTCGGATATTCCTCGAGGAATATCCGAAAGTGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001671
MAP3K15 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001671.1-3341s1c1
Sequence:CCGGGATTTCAGGATGCCGTAAATACTCGAGTATTTACGGCATCCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001671.1-4462s1c1
Sequence:CCGGCCTCAGAACTGGTATGGTACTCTCGAGAGTACCATACCAGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001671.1-1809s1c1
Sequence:CCGGCCTATCAAAGTTTGATGAAAGCTCGAGCTTTCATCAAACTTTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001671.1-4509s1c1
Sequence:CCGGCGAATGTGCCTTGTAGTTAATCTCGAGATTAACTACAAGGCACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001671.1-3854s1c1
Sequence:CCGGGTTATACACTTTCGGATATTCCTCGAGGAATATCCGAAAGTGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001671
MAP3K15 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001671.1-3341s1c1
Sequence:CCGGGATTTCAGGATGCCGTAAATACTCGAGTATTTACGGCATCCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001671.1-4462s1c1
Sequence:CCGGCCTCAGAACTGGTATGGTACTCTCGAGAGTACCATACCAGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001671.1-1809s1c1
Sequence:CCGGCCTATCAAAGTTTGATGAAAGCTCGAGCTTTCATCAAACTTTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001671.1-4509s1c1
Sequence:CCGGCGAATGTGCCTTGTAGTTAATCTCGAGATTAACTACAAGGCACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001671.1-3854s1c1
Sequence:CCGGGTTATACACTTTCGGATATTCCTCGAGGAATATCCGAAAGTGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486812
MAP3K15 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486812.2-3975s1c1
Sequence:CCGGGTACTCACAAACTCCGAGTTTCTCGAGAAACTCGGAGTTTGTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-246s1c1
Sequence:CCGGGCTCTCTATAATGCAAACTATCTCGAGATAGTTTGCATTATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-730s1c1
Sequence:CCGGCGGATCAAATTCCGTATGGATCTCGAGATCCATACGGAATTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-2968s1c1
Sequence:CCGGGCCATCCTTTACAGAATCCTTCTCGAGAAGGATTCTGTAAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-1447s1c1
Sequence:CCGGCGGCTTAACTTCTGGTTAGATCTCGAGATCTAACCAGAAGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486812
MAP3K15 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486812.2-3975s1c1
Sequence:CCGGGTACTCACAAACTCCGAGTTTCTCGAGAAACTCGGAGTTTGTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-246s1c1
Sequence:CCGGGCTCTCTATAATGCAAACTATCTCGAGATAGTTTGCATTATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-730s1c1
Sequence:CCGGCGGATCAAATTCCGTATGGATCTCGAGATCCATACGGAATTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-2968s1c1
Sequence:CCGGGCCATCCTTTACAGAATCCTTCTCGAGAAGGATTCTGTAAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-1447s1c1
Sequence:CCGGCGGCTTAACTTCTGGTTAGATCTCGAGATCTAACCAGAAGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486812
MAP3K15 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486812.2-3975s1c1
Sequence:CCGGGTACTCACAAACTCCGAGTTTCTCGAGAAACTCGGAGTTTGTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-246s1c1
Sequence:CCGGGCTCTCTATAATGCAAACTATCTCGAGATAGTTTGCATTATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-730s1c1
Sequence:CCGGCGGATCAAATTCCGTATGGATCTCGAGATCCATACGGAATTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-2968s1c1
Sequence:CCGGGCCATCCTTTACAGAATCCTTCTCGAGAAGGATTCTGTAAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486812.2-1447s1c1
Sequence:CCGGCGGCTTAACTTCTGGTTAGATCTCGAGATCTAACCAGAAGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks