EMAIL THIS PAGE TO A FRIEND

MAP3K1

mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase

Synonyms: MAPKKK1 MEKK MEKK 1 MEKK1 SRXY6
UniProtKB ID: Q13233
Gene ID:
Human(4214) Summary: The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
Mouse(26401) mitogen-activated protein kinase kinase kinase 1
Rat(116667) mitogen activated protein kinase kinase kinase 1
sheep(101112260) mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
domestic guinea pig(100723456) mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
naked mole-rat(101720769) mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Domestic Rabbit(100328655) mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Zebrafish(100334486) mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
chicken(427144) mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
cow(523962) mitogen-activated protein kinase kinase kinase 1
Horse(100061688) mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
domestic cat(101090328) mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
dog(478061) mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
276 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P215 PD 98,059 solid human pricing
A8626 Adenine ≥99% human, mouse, rat pricing
A2786 Adenine suitable for cell culture, BioReagent human, mouse, rat pricing
A5665 Adenine BioReagent, plant cell culture tested, ≥99% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005921 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_042066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_042066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_042066 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005921 Rosetta Predictions human pricing
XM_042066 Rosetta Predictions human pricing
NM_053887 Rosetta Predictions rat pricing
NM_011945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340548 predicted 2789
2 SASI_Hs02_00340549 predicted 2775
3 SASI_Hs02_00340550 predicted 2528
4 SASI_Hs02_00340551 predicted 4603
5 SASI_Hs02_00340552 predicted 1453
6 SASI_Hs02_00340553 predicted 4386
7 SASI_Hs02_00340554 predicted 4753
8 SASI_Hs02_00340555 predicted 2141
9 SASI_Hs02_00340556 predicted 1828
10 SASI_Hs02_00340557 predicted 2605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_042066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297378 predicted 2857
2 SASI_Hs01_00297379 predicted 2843
3 SASI_Hs01_00297380 predicted 2584
4 SASI_Hs01_00297381 predicted 3918
5 SASI_Hs01_00297382 predicted 1873
6 SASI_Hs01_00297383 predicted 2647
7 SASI_Hs01_00297384 predicted 4443
8 SASI_Hs01_00297385 predicted 4262
9 SASI_Hs01_00297386 predicted 4820
10 SASI_Hs01_00297387 predicted 2199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104165 predicted 2805
2 SASI_Rn01_00104166 predicted 4756
3 SASI_Rn01_00104169 predicted 1977
4 SASI_Rn01_00104170 predicted 1116
5 SASI_Rn02_00266806 predicted 1918
6 SASI_Rn01_00104171 predicted 1487
7 SASI_Rn01_00104173 predicted 4761
8 SASI_Rn02_00266807 predicted 1874
9 SASI_Rn01_00104174 predicted 3887
10 SASI_Rn02_00266808 predicted 2689
11 SASI_Rn01_00104167 predicted 3391
12 SASI_Rn01_00104168 predicted 4199
13 SASI_Rn01_00104172 predicted 3057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027733 predicted 2942
2 SASI_Mm01_00027734 predicted 1737
3 SASI_Mm01_00027735 predicted 3693
4 SASI_Mm01_00027736 predicted 4247
5 SASI_Mm01_00027737 predicted 3449
6 SASI_Mm01_00027738 predicted 4210
7 SASI_Mm01_00027739 predicted 1725
8 SASI_Mm01_00027740 predicted 3594
9 SASI_Mm01_00027741 predicted 3765
10 SASI_Mm02_00321805 predicted 993
11 SASI_Mm01_00027742 predicted 1439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011945
MAP3K1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-3979s21c1
Sequence:CCGGTCAAGGAGTCAGTCGTCATTACTCGAGTAATGACGACTGACTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-2887s21c1
Sequence:CCGGCTTTGTCTCATGCTCAATTAACTCGAGTTAATTGAGCATGAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-4480s21c1
Sequence:CCGGTCCGTACCACGTGGTAGTTAACTCGAGTTAACTACCACGTGGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-635s21c1
Sequence:CCGGGGTGAAGCCAATCCCTATTAACTCGAGTTAATAGGGATTGGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-4267s1c1
Sequence:CCGGGCGCCATTATAGAAATGGCTTCTCGAGAAGCCATTTCTATAATGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-2273s1c1
Sequence:CCGGCCTCTGTCTTATAGACAGGTTCTCGAGAACCTGTCTATAAGACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-3118s1c1
Sequence:CCGGCCAGTAACATACACAGGCCAACTCGAGTTGGCCTGTGTATGTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-479s1c1
Sequence:CCGGCGGTCGAGAGATGGAGAATAACTCGAGTTATTCTCCATCTCTCGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-1643s1c1
Sequence:CCGGGCAGATTCCTTCCGCTTACAACTCGAGTTGTAAGCGGAAGGAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011945
MAP3K1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-3979s21c1
Sequence:CCGGTCAAGGAGTCAGTCGTCATTACTCGAGTAATGACGACTGACTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-2887s21c1
Sequence:CCGGCTTTGTCTCATGCTCAATTAACTCGAGTTAATTGAGCATGAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-4480s21c1
Sequence:CCGGTCCGTACCACGTGGTAGTTAACTCGAGTTAACTACCACGTGGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-635s21c1
Sequence:CCGGGGTGAAGCCAATCCCTATTAACTCGAGTTAATAGGGATTGGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-4267s1c1
Sequence:CCGGGCGCCATTATAGAAATGGCTTCTCGAGAAGCCATTTCTATAATGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-2273s1c1
Sequence:CCGGCCTCTGTCTTATAGACAGGTTCTCGAGAACCTGTCTATAAGACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-3118s1c1
Sequence:CCGGCCAGTAACATACACAGGCCAACTCGAGTTGGCCTGTGTATGTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-479s1c1
Sequence:CCGGCGGTCGAGAGATGGAGAATAACTCGAGTTATTCTCCATCTCTCGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-1643s1c1
Sequence:CCGGGCAGATTCCTTCCGCTTACAACTCGAGTTGTAAGCGGAAGGAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011945
MAP3K1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-3979s21c1
Sequence:CCGGTCAAGGAGTCAGTCGTCATTACTCGAGTAATGACGACTGACTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-2887s21c1
Sequence:CCGGCTTTGTCTCATGCTCAATTAACTCGAGTTAATTGAGCATGAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-4480s21c1
Sequence:CCGGTCCGTACCACGTGGTAGTTAACTCGAGTTAACTACCACGTGGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011945.2-635s21c1
Sequence:CCGGGGTGAAGCCAATCCCTATTAACTCGAGTTAATAGGGATTGGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-4267s1c1
Sequence:CCGGGCGCCATTATAGAAATGGCTTCTCGAGAAGCCATTTCTATAATGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-2273s1c1
Sequence:CCGGCCTCTGTCTTATAGACAGGTTCTCGAGAACCTGTCTATAAGACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-3118s1c1
Sequence:CCGGCCAGTAACATACACAGGCCAACTCGAGTTGGCCTGTGTATGTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-479s1c1
Sequence:CCGGCGGTCGAGAGATGGAGAATAACTCGAGTTATTCTCCATCTCTCGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011945.1-1643s1c1
Sequence:CCGGGCAGATTCCTTCCGCTTACAACTCGAGTTGTAAGCGGAAGGAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005921
MAP3K1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000315395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005921.1-3417s21c1
Sequence:CCGGATCTCATCATTCCCAATTAATCTCGAGATTAATTGGGAATGATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005921.1-1685s21c1
Sequence:CCGGGGCGTAGCTCAAGGATCAAAGCTCGAGCTTTGATCCTTGAGCTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005921.1-5297s21c1
Sequence:CCGGTGAAGTTTGCATGACTAAATTCTCGAGAATTTAGTCATGCAAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005921.1-2501s21c1
Sequence:CCGGGCCACAGTTTAGCGGAAAGAACTCGAGTTCTTTCCGCTAAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005921
MAP3K1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000315395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005921.1-3417s21c1
Sequence:CCGGATCTCATCATTCCCAATTAATCTCGAGATTAATTGGGAATGATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005921.1-1685s21c1
Sequence:CCGGGGCGTAGCTCAAGGATCAAAGCTCGAGCTTTGATCCTTGAGCTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005921.1-5297s21c1
Sequence:CCGGTGAAGTTTGCATGACTAAATTCTCGAGAATTTAGTCATGCAAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005921.1-2501s21c1
Sequence:CCGGGCCACAGTTTAGCGGAAAGAACTCGAGTTCTTTCCGCTAAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005921
MAP3K1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000315395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005921.1-3417s21c1
Sequence:CCGGATCTCATCATTCCCAATTAATCTCGAGATTAATTGGGAATGATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005921.1-1685s21c1
Sequence:CCGGGGCGTAGCTCAAGGATCAAAGCTCGAGCTTTGATCCTTGAGCTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005921.1-5297s21c1
Sequence:CCGGTGAAGTTTGCATGACTAAATTCTCGAGAATTTAGTCATGCAAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005921.1-2501s21c1
Sequence:CCGGGCCACAGTTTAGCGGAAAGAACTCGAGTTCTTTCCGCTAAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_042066
VALIDATED
MAP3K1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_042066.8-5517s1c1
Sequence:CCGGCCACTCTTATTGTGCAGGTTACTCGAGTAACCTGCACAATAAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042066.8-2508s1c1
Sequence:CCGGGCCTGTTGAAATCAGGTATAACTCGAGTTATACCTGATTTCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.8-633s1c1
Sequence:CCGGCGGTCGTGAGATGGAGAATAACTCGAGTTATTCTCCATCTCACGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.8-3059s1c1
Sequence:CCGGCCTCTCCTTTATCTCATCATTCTCGAGAATGATGAGATAAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.8-4220s1c1
Sequence:CCGGGCCTTTCGTATCTCCATGAAACTCGAGTTTCATGGAGATACGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-2708s1c1
Sequence:CCGGGCCACAGTTTAGCGGAAAGAACTCGAGTTCTTTCCGCTAAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-5155s1c1
Sequence:CCGGGATGTGGCTCTTCGTTGTTTACTCGAGTAAACAACGAAGAGCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-7305s1c1
Sequence:CCGGCTGGAAATTGTATCGTGTAATCTCGAGATTACACGATACAATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-4702s1c1
Sequence:CCGGGCTCATTTGCTGAGTAAATATCTCGAGATATTTACTCAGCAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_042066.11-5769s1c1
Sequence:CCGGGACCCACAGTTGACCTTTATTCTCGAGAATAAAGGTCAACTGTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_042066.11-3998s1c1
Sequence:CCGGGTAGCAGCAATAGTAGTAATGCTCGAGCATTACTACTATTGCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_042066.11-4658s1c1
Sequence:CCGGGCAATTACAATCTCTTCATTGCTCGAGCAATGAAGAGATTGTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_042066
VALIDATED
MAP3K1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_042066.8-5517s1c1
Sequence:CCGGCCACTCTTATTGTGCAGGTTACTCGAGTAACCTGCACAATAAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042066.8-2508s1c1
Sequence:CCGGGCCTGTTGAAATCAGGTATAACTCGAGTTATACCTGATTTCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.8-633s1c1
Sequence:CCGGCGGTCGTGAGATGGAGAATAACTCGAGTTATTCTCCATCTCACGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.8-3059s1c1
Sequence:CCGGCCTCTCCTTTATCTCATCATTCTCGAGAATGATGAGATAAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.8-4220s1c1
Sequence:CCGGGCCTTTCGTATCTCCATGAAACTCGAGTTTCATGGAGATACGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-2708s1c1
Sequence:CCGGGCCACAGTTTAGCGGAAAGAACTCGAGTTCTTTCCGCTAAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-5155s1c1
Sequence:CCGGGATGTGGCTCTTCGTTGTTTACTCGAGTAAACAACGAAGAGCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-7305s1c1
Sequence:CCGGCTGGAAATTGTATCGTGTAATCTCGAGATTACACGATACAATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-4702s1c1
Sequence:CCGGGCTCATTTGCTGAGTAAATATCTCGAGATATTTACTCAGCAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_042066.11-5769s1c1
Sequence:CCGGGACCCACAGTTGACCTTTATTCTCGAGAATAAAGGTCAACTGTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_042066.11-3998s1c1
Sequence:CCGGGTAGCAGCAATAGTAGTAATGCTCGAGCATTACTACTATTGCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_042066.11-4658s1c1
Sequence:CCGGGCAATTACAATCTCTTCATTGCTCGAGCAATGAAGAGATTGTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_042066
VALIDATED
MAP3K1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_042066.8-5517s1c1
Sequence:CCGGCCACTCTTATTGTGCAGGTTACTCGAGTAACCTGCACAATAAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042066.8-2508s1c1
Sequence:CCGGGCCTGTTGAAATCAGGTATAACTCGAGTTATACCTGATTTCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.8-633s1c1
Sequence:CCGGCGGTCGTGAGATGGAGAATAACTCGAGTTATTCTCCATCTCACGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.8-3059s1c1
Sequence:CCGGCCTCTCCTTTATCTCATCATTCTCGAGAATGATGAGATAAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.8-4220s1c1
Sequence:CCGGGCCTTTCGTATCTCCATGAAACTCGAGTTTCATGGAGATACGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-2708s1c1
Sequence:CCGGGCCACAGTTTAGCGGAAAGAACTCGAGTTCTTTCCGCTAAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-5155s1c1
Sequence:CCGGGATGTGGCTCTTCGTTGTTTACTCGAGTAAACAACGAAGAGCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-7305s1c1
Sequence:CCGGCTGGAAATTGTATCGTGTAATCTCGAGATTACACGATACAATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_042066.11-4702s1c1
Sequence:CCGGGCTCATTTGCTGAGTAAATATCTCGAGATATTTACTCAGCAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_042066.11-5769s1c1
Sequence:CCGGGACCCACAGTTGACCTTTATTCTCGAGAATAAAGGTCAACTGTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_042066.11-3998s1c1
Sequence:CCGGGTAGCAGCAATAGTAGTAATGCTCGAGCATTACTACTATTGCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_042066.11-4658s1c1
Sequence:CCGGGCAATTACAATCTCTTCATTGCTCGAGCAATGAAGAGATTGTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks