EMAIL THIS PAGE TO A FRIEND

MAP4

microtubule-associated protein 4

Gene ID:
Human(4134) Summary: The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(17758) microtubule-associated protein 4
Rat(367171) microtubule-associated protein 4
chicken(396097) microtubule-associated protein 4
cow(281295) microtubule-associated protein 4
Horse(100064374) microtubule-associated protein 4
domestic cat(100302596) microtubule-associated protein 4
dog(484781) microtubule-associated protein 4
naked mole-rat(101702000) microtubule-associated protein 4
Domestic Rabbit(100337731) microtubule-associated protein 4
domestic guinea pig(100725145) microtubule-associated protein 4
sheep(101113439) microtubule-associated protein 4
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002375 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080651 MISSION® esiRNA esiRNA targeting mouse Mtap4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002375 Rosetta Predictions human pricing
NM_030884 Rosetta Predictions human pricing
NM_030885 Rosetta Predictions human pricing
NM_001024278 Rosetta Predictions rat pricing
NM_008633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232597 predicted 3490
2 SASI_Hs01_00232598 predicted 3371
3 SASI_Hs01_00232599 predicted 3904
4 SASI_Hs01_00232600 predicted 3921
5 SASI_Hs01_00232601 predicted 2954
6 SASI_Hs01_00232602 predicted 3931
7 SASI_Hs01_00232603 predicted 3400
8 SASI_Hs01_00232604 predicted 2966
9 SASI_Hs01_00232605 predicted 3234
10 SASI_Hs01_00232606 predicted 3000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184622 predicted 2299
2 SASI_Hs01_00184623 predicted 2361
3 SASI_Hs01_00184624 predicted 1762
4 SASI_Hs01_00184625 predicted 3092
5 SASI_Hs01_00184626 predicted 2169
6 SASI_Hs01_00184627 predicted 1971
7 SASI_Hs01_00184629 predicted 2212
8 SASI_Hs01_00184630 predicted 2049
9 SASI_Hs01_00184631 predicted 1816
10 SASI_Hs02_00358417 predicted 2348
11 SASI_Hs01_00184628 predicted 2509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136826 predicted 529
2 SASI_Hs01_00136827 predicted 537
3 SASI_Hs01_00136828 predicted 510
4 SASI_Hs01_00136829 predicted 476
5 SASI_Hs01_00136830 predicted 531
6 SASI_Hs01_00136831 predicted 509
7 SASI_Hs01_00136832 predicted 478
8 SASI_Hs02_00358418 predicted 467
9 SASI_Hs01_00136833 predicted 482
10 SASI_Hs02_00358419 predicted 480
11 SASI_Hs01_00136824 predicted 502
12 SASI_Hs01_00136825 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202458 predicted 1398
2 SASI_Rn02_00202459 predicted 420
3 SASI_Rn01_00111091 predicted 2022
4 SASI_Rn02_00202460 predicted 2478
5 SASI_Rn01_00111094 predicted 2152
6 SASI_Rn01_00111096 predicted 365
7 SASI_Rn01_00111098 predicted 1971
8 SASI_Rn02_00202461 predicted 1691
9 SASI_Rn01_00111099 predicted 985
10 SASI_Rn01_00111100 predicted 673
11 SASI_Rn01_00111092 predicted 839
12 SASI_Rn01_00111093 predicted 1707
13 SASI_Rn01_00111095 predicted 1112
14 SASI_Rn01_00111097 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314351 predicted 3122
2 SASI_Mm02_00314352 predicted 1536
3 SASI_Mm01_00107888 predicted 1664
4 SASI_Mm01_00107890 predicted 1050
5 SASI_Mm01_00107892 predicted 3010
6 SASI_Mm01_00107893 predicted 1455
7 SASI_Mm01_00107894 predicted 2216
8 SASI_Mm01_00107896 predicted 1019
9 SASI_Mm01_00107897 predicted 2484
10 SASI_Mm02_00314353 predicted 2036
11 SASI_Mm01_00107889 predicted 2834
12 SASI_Mm01_00107891 predicted 3870
13 SASI_Mm01_00107895 predicted 3861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008633
VALIDATED
MAP4 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008633.1-5762s1c1
Sequence:CCGGCCCTCCTTGATGTTGATCTTACTCGAGTAAGATCAACATCAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008633.1-2303s1c1
Sequence:CCGGGCAGAACAAATGTCTACCTTACTCGAGTAAGGTAGACATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008633.1-530s1c1
Sequence:CCGGCCTCCAGAAATTGAGGGAGAACTCGAGTTCTCCCTCAATTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008633.1-1418s1c1
Sequence:CCGGGCCCACGCTAACAATATCATACTCGAGTATGATATTGTTAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008633.1-1420s1c1
Sequence:CCGGCCACGCTAACAATATCATATTCTCGAGAATATGATATTGTTAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-1114s21c1
Sequence:CCGGGCCCACGCTAACAATATCATACTCGAGTATGATATTGTTAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008633.3-3825s21c1
Sequence:CCGGGCCAACTCCAACTTCACTATCCTCGAGGATAGTGAAGTTGGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-505s21c1
Sequence:CCGGAGAGTGGACTATCCGGATTATCTCGAGATAATCCGGATAGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-662s21c1
Sequence:CCGGCCACGAACGCTTCTGCATTTACTCGAGTAAATGCAGAAGCGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-1050s21c1
Sequence:CCGGGCCATCTACTGAATCGGATATCTCGAGATATCCGATTCAGTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008633
VALIDATED
MAP4 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008633.1-5762s1c1
Sequence:CCGGCCCTCCTTGATGTTGATCTTACTCGAGTAAGATCAACATCAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008633.1-2303s1c1
Sequence:CCGGGCAGAACAAATGTCTACCTTACTCGAGTAAGGTAGACATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008633.1-530s1c1
Sequence:CCGGCCTCCAGAAATTGAGGGAGAACTCGAGTTCTCCCTCAATTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008633.1-1418s1c1
Sequence:CCGGGCCCACGCTAACAATATCATACTCGAGTATGATATTGTTAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008633.1-1420s1c1
Sequence:CCGGCCACGCTAACAATATCATATTCTCGAGAATATGATATTGTTAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-1114s21c1
Sequence:CCGGGCCCACGCTAACAATATCATACTCGAGTATGATATTGTTAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008633.3-3825s21c1
Sequence:CCGGGCCAACTCCAACTTCACTATCCTCGAGGATAGTGAAGTTGGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-505s21c1
Sequence:CCGGAGAGTGGACTATCCGGATTATCTCGAGATAATCCGGATAGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-662s21c1
Sequence:CCGGCCACGAACGCTTCTGCATTTACTCGAGTAAATGCAGAAGCGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-1050s21c1
Sequence:CCGGGCCATCTACTGAATCGGATATCTCGAGATATCCGATTCAGTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008633
VALIDATED
MAP4 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008633.1-5762s1c1
Sequence:CCGGCCCTCCTTGATGTTGATCTTACTCGAGTAAGATCAACATCAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008633.1-2303s1c1
Sequence:CCGGGCAGAACAAATGTCTACCTTACTCGAGTAAGGTAGACATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008633.1-530s1c1
Sequence:CCGGCCTCCAGAAATTGAGGGAGAACTCGAGTTCTCCCTCAATTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008633.1-1418s1c1
Sequence:CCGGGCCCACGCTAACAATATCATACTCGAGTATGATATTGTTAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008633.1-1420s1c1
Sequence:CCGGCCACGCTAACAATATCATATTCTCGAGAATATGATATTGTTAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-1114s21c1
Sequence:CCGGGCCCACGCTAACAATATCATACTCGAGTATGATATTGTTAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008633.3-3825s21c1
Sequence:CCGGGCCAACTCCAACTTCACTATCCTCGAGGATAGTGAAGTTGGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-505s21c1
Sequence:CCGGAGAGTGGACTATCCGGATTATCTCGAGATAATCCGGATAGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-662s21c1
Sequence:CCGGCCACGAACGCTTCTGCATTTACTCGAGTAAATGCAGAAGCGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008633.3-1050s21c1
Sequence:CCGGGCCATCTACTGAATCGGATATCTCGAGATATCCGATTCAGTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002375
VALIDATED
MAP4 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002375.3-4395s1c1
Sequence:CCGGCCAGATTCTATCCTCATCTTTCTCGAGAAAGATGAGGATAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002375.3-795s1c1
Sequence:CCGGCCTACCAGGAATACCCAAATACTCGAGTATTTGGGTATTCCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002375.3-1840s1c1
Sequence:CCGGCGTGATCTTGACCAAGGATAACTCGAGTTATCCTTGGTCAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002375.3-1413s1c1
Sequence:CCGGCCCTGGTTAAGGATGTCAGATCTCGAGATCTGACATCCTTAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002375.3-2661s1c1
Sequence:CCGGCCACCATTGGTGGGTTGAATACTCGAGTATTCAACCCACCAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002375.4-852s21c1
Sequence:CCGGCCTACCAGGAATACCCAAATACTCGAGTATTTGGGTATTCCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002375.4-1897s21c1
Sequence:CCGGCGTGATCTTGACCAAGGATAACTCGAGTTATCCTTGGTCAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002375.4-930s21c1
Sequence:CCGGCTATCCAGACTGATCCCTTTACTCGAGTAAAGGGATCAGTCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002375.4-4439s21c1
Sequence:CCGGTAGGAGAGGAGAACCAGATTCCTCGAGGAATCTGGTTCTCCTCTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002375
VALIDATED
MAP4 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002375.3-4395s1c1
Sequence:CCGGCCAGATTCTATCCTCATCTTTCTCGAGAAAGATGAGGATAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002375.3-795s1c1
Sequence:CCGGCCTACCAGGAATACCCAAATACTCGAGTATTTGGGTATTCCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002375.3-1840s1c1
Sequence:CCGGCGTGATCTTGACCAAGGATAACTCGAGTTATCCTTGGTCAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002375.3-1413s1c1
Sequence:CCGGCCCTGGTTAAGGATGTCAGATCTCGAGATCTGACATCCTTAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002375.3-2661s1c1
Sequence:CCGGCCACCATTGGTGGGTTGAATACTCGAGTATTCAACCCACCAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002375.4-852s21c1
Sequence:CCGGCCTACCAGGAATACCCAAATACTCGAGTATTTGGGTATTCCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002375.4-1897s21c1
Sequence:CCGGCGTGATCTTGACCAAGGATAACTCGAGTTATCCTTGGTCAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002375.4-930s21c1
Sequence:CCGGCTATCCAGACTGATCCCTTTACTCGAGTAAAGGGATCAGTCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002375.4-4439s21c1
Sequence:CCGGTAGGAGAGGAGAACCAGATTCCTCGAGGAATCTGGTTCTCCTCTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002375
VALIDATED
MAP4 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002375.3-4395s1c1
Sequence:CCGGCCAGATTCTATCCTCATCTTTCTCGAGAAAGATGAGGATAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002375.3-795s1c1
Sequence:CCGGCCTACCAGGAATACCCAAATACTCGAGTATTTGGGTATTCCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002375.3-1840s1c1
Sequence:CCGGCGTGATCTTGACCAAGGATAACTCGAGTTATCCTTGGTCAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002375.3-1413s1c1
Sequence:CCGGCCCTGGTTAAGGATGTCAGATCTCGAGATCTGACATCCTTAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002375.3-2661s1c1
Sequence:CCGGCCACCATTGGTGGGTTGAATACTCGAGTATTCAACCCACCAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002375.4-852s21c1
Sequence:CCGGCCTACCAGGAATACCCAAATACTCGAGTATTTGGGTATTCCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002375.4-1897s21c1
Sequence:CCGGCGTGATCTTGACCAAGGATAACTCGAGTTATCCTTGGTCAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002375.4-930s21c1
Sequence:CCGGCTATCCAGACTGATCCCTTTACTCGAGTAAAGGGATCAGTCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002375.4-4439s21c1
Sequence:CCGGTAGGAGAGGAGAACCAGATTCCTCGAGGAATCTGGTTCTCCTCTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks