EMAIL THIS PAGE TO A FRIEND

MAP7D1

MAP7 domain containing 1

Synonyms: PARCC1 RPRC1
Gene ID:
Mouse(245877) MAP7 domain containing 1
Rat(681287) MAP7 domain containing 1
chicken(419624) MAP7 domain containing 1
domestic cat(101087080) MAP7 domain containing 1
cow(512106) MAP7 domain containing 1
dog(608497) MAP7 domain containing 1
sheep(101112772) MAP7 domain containing 1
domestic guinea pig(100732115) MAP7 domain containing 1
naked mole-rat(101711915) MAP7 domain containing 1
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018067 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123711 MISSION® esiRNA esiRNA human MAP7D1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018067 Rosetta Predictions human pricing
NM_001109438 Rosetta Predictions rat pricing
NM_144941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110280 predicted 853
2 SASI_Hs01_00110281 predicted 2890
3 SASI_Hs01_00110282 predicted 973
4 SASI_Hs01_00110283 predicted 3018
5 SASI_Hs01_00110284 predicted 2682
6 SASI_Hs01_00110285 predicted 1076
7 SASI_Hs01_00110286 predicted 2721
8 SASI_Hs01_00110288 predicted 2678
9 SASI_Hs01_00110289 predicted 2747
10 SASI_Hs02_00351210 predicted 2733
11 SASI_Hs01_00110287 predicted 2658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248407 predicted 894
2 SASI_Rn02_00248408 predicted 2682
3 SASI_Rn02_00248409 predicted 505
4 SASI_Rn02_00248410 predicted 1016
5 SASI_Rn02_00248411 predicted 694
6 SASI_Rn02_00248412 predicted 1031
7 SASI_Rn02_00248413 predicted 2765
8 SASI_Rn02_00248414 predicted 705
9 SASI_Rn02_00248415 predicted 2688
10 SASI_Rn02_00248416 predicted 2727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159885 predicted 2757
2 SASI_Mm01_00159886 predicted 2752
3 SASI_Mm01_00159887 predicted 878
4 SASI_Mm01_00159888 predicted 2437
5 SASI_Mm01_00159889 predicted 998
6 SASI_Mm02_00340465 predicted 2750
7 SASI_Mm01_00159890 predicted 2421
8 SASI_Mm01_00159891 predicted 1011
9 SASI_Mm01_00159892 predicted 2402
10 SASI_Mm01_00159893 predicted 683
11 SASI_Mm01_00159894 predicted 2127
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018067
MAP7D1 MISSION shRNA Bacterial Glycerol Stock
MAP7 domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-2722s21c1
Sequence:CCGGCAGGTCACAGAAGTCCTTTAACTCGAGTTAAAGGACTTCTGTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018067.3-3156s21c1
Sequence:CCGGAGATCTTCCTCTCTCTATTTACTCGAGTAAATAGAGAGAGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-2370s21c1
Sequence:CCGGGACTCGGAAGTCAGAAGTTTCCTCGAGGAAACTTCTGACTTCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-759s21c1
Sequence:CCGGGCTGGAGGAGCAACGTCTTAACTCGAGTTAAGACGTTGCTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-993s21c1
Sequence:CCGGCAAACACGTGGACTCTATAATCTCGAGATTATAGAGTCCACGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2182s1c1
Sequence:CCGGGCAGGTCACAGAAGTCCTTTACTCGAGTAAAGGACTTCTGTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2190s1c1
Sequence:CCGGCAGAAGTCCTTTAAGAGGGTTCTCGAGAACCCTCTTAAAGGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2117s1c1
Sequence:CCGGCCAGAGACACTCCTGCCCTTTCTCGAGAAAGGGCAGGAGTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2144s1c1
Sequence:CCGGGCAGAAGCCTTCCTCAAGAAACTCGAGTTTCTTGAGGAAGGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018067
MAP7D1 MISSION shRNA shRNA Plasmid DNA
MAP7 domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-2722s21c1
Sequence:CCGGCAGGTCACAGAAGTCCTTTAACTCGAGTTAAAGGACTTCTGTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018067.3-3156s21c1
Sequence:CCGGAGATCTTCCTCTCTCTATTTACTCGAGTAAATAGAGAGAGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-2370s21c1
Sequence:CCGGGACTCGGAAGTCAGAAGTTTCCTCGAGGAAACTTCTGACTTCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-759s21c1
Sequence:CCGGGCTGGAGGAGCAACGTCTTAACTCGAGTTAAGACGTTGCTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-993s21c1
Sequence:CCGGCAAACACGTGGACTCTATAATCTCGAGATTATAGAGTCCACGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2182s1c1
Sequence:CCGGGCAGGTCACAGAAGTCCTTTACTCGAGTAAAGGACTTCTGTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2190s1c1
Sequence:CCGGCAGAAGTCCTTTAAGAGGGTTCTCGAGAACCCTCTTAAAGGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2117s1c1
Sequence:CCGGCCAGAGACACTCCTGCCCTTTCTCGAGAAAGGGCAGGAGTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2144s1c1
Sequence:CCGGGCAGAAGCCTTCCTCAAGAAACTCGAGTTTCTTGAGGAAGGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018067
MAP7D1 MISSION shRNA Lentiviral Transduction Particles
MAP7 domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-2722s21c1
Sequence:CCGGCAGGTCACAGAAGTCCTTTAACTCGAGTTAAAGGACTTCTGTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018067.3-3156s21c1
Sequence:CCGGAGATCTTCCTCTCTCTATTTACTCGAGTAAATAGAGAGAGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-2370s21c1
Sequence:CCGGGACTCGGAAGTCAGAAGTTTCCTCGAGGAAACTTCTGACTTCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-759s21c1
Sequence:CCGGGCTGGAGGAGCAACGTCTTAACTCGAGTTAAGACGTTGCTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018067.3-993s21c1
Sequence:CCGGCAAACACGTGGACTCTATAATCTCGAGATTATAGAGTCCACGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2182s1c1
Sequence:CCGGGCAGGTCACAGAAGTCCTTTACTCGAGTAAAGGACTTCTGTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2190s1c1
Sequence:CCGGCAGAAGTCCTTTAAGAGGGTTCTCGAGAACCCTCTTAAAGGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2117s1c1
Sequence:CCGGCCAGAGACACTCCTGCCCTTTCTCGAGAAAGGGCAGGAGTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018067.2-2144s1c1
Sequence:CCGGGCAGAAGCCTTCCTCAAGAAACTCGAGTTTCTTGAGGAAGGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144941
MAP7D1 MISSION shRNA Bacterial Glycerol Stock
MAP7 domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144941.2-3250s1c1
Sequence:CCGGGCCACACAATACTGGTTGCTTCTCGAGAAGCAACCAGTATTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-2750s1c1
Sequence:CCGGCCACAGGTCACAGAAGTTCTTCTCGAGAAGAACTTCTGTGACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-1021s1c1
Sequence:CCGGCGTGGACTCTATAATCAACAACTCGAGTTGTTGATTATAGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-1122s1c1
Sequence:CCGGGCATTGTGGATCGTCTGATGACTCGAGTCATCAGACGATCCACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-614s1c1
Sequence:CCGGCCTCCTGCCAAGCAAGATGTACTCGAGTACATCTTGCTTGGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144941
MAP7D1 MISSION shRNA shRNA Plasmid DNA
MAP7 domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144941.2-3250s1c1
Sequence:CCGGGCCACACAATACTGGTTGCTTCTCGAGAAGCAACCAGTATTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-2750s1c1
Sequence:CCGGCCACAGGTCACAGAAGTTCTTCTCGAGAAGAACTTCTGTGACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-1021s1c1
Sequence:CCGGCGTGGACTCTATAATCAACAACTCGAGTTGTTGATTATAGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-1122s1c1
Sequence:CCGGGCATTGTGGATCGTCTGATGACTCGAGTCATCAGACGATCCACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-614s1c1
Sequence:CCGGCCTCCTGCCAAGCAAGATGTACTCGAGTACATCTTGCTTGGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144941
MAP7D1 MISSION shRNA Lentiviral Transduction Particles
MAP7 domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144941.2-3250s1c1
Sequence:CCGGGCCACACAATACTGGTTGCTTCTCGAGAAGCAACCAGTATTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-2750s1c1
Sequence:CCGGCCACAGGTCACAGAAGTTCTTCTCGAGAAGAACTTCTGTGACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-1021s1c1
Sequence:CCGGCGTGGACTCTATAATCAACAACTCGAGTTGTTGATTATAGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-1122s1c1
Sequence:CCGGGCATTGTGGATCGTCTGATGACTCGAGTCATCAGACGATCCACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144941.2-614s1c1
Sequence:CCGGCCTCCTGCCAAGCAAGATGTACTCGAGTACATCTTGCTTGGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks