EMAIL THIS PAGE TO A FRIEND

MAPK11

mitogen-activated protein kinase 11

Synonyms: P38B P38BETA2 PRKM11 SAPK2 SAPK2B p38-2 p38Beta
UniProtKB ID: Q15759, B0LPG1, O00284, O15472, Q2XNF2
Gene ID:
Human(5600) Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation, and development. This kinase is most closely related to p38 MAP kinase, both of which can be activated by proinflammatory cytokines and environmental stress. This kinase is activated through its phosphorylation by MAP kinase kinases (MKKs), preferably by MKK6. Transcription factor ATF2/CREB2 has been shown to be a substrate of this kinase. [provided by RefSeq, Jul 2008]
Mouse(19094) mitogen-activated protein kinase 11
Rat(689314) mitogen-activated protein kinase 11
Zebrafish(415185) mitogen-activated protein kinase 11
chicken(417739) mitogen-activated protein kinase 11
dog(607019) mitogen-activated protein kinase 11
domestic cat(101081396) mitogen-activated protein kinase 11
cow(618906) mitogen-activated protein kinase 11
domestic guinea pig(100724974) mitogen-activated protein kinase 11
naked mole-rat(101705370) mitogen-activated protein kinase 11
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0845 AQUA Peptide GANPLAIDLLE[K] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002751 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002751 Rosetta Predictions human pricing
NM_138993 Rosetta Predictions human pricing
NM_001109532 Rosetta Predictions rat pricing
NM_011161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071113 predicted 893
2 SASI_Hs01_00071114 predicted 425
3 SASI_Hs01_00071115 predicted 806
4 SASI_Hs01_00071116 predicted 370
5 SASI_Hs02_00334365 predicted 1638
6 SASI_Hs01_00071118 predicted 726
7 SASI_Hs02_00334366 predicted 619
8 SASI_Hs01_00071119 predicted 1013
9 SASI_Hs02_00334367 predicted 1566
10 SASI_Hs01_00071120 predicted 592
11 SASI_Hs01_00071117 predicted 719
12 SASI_Hs01_00071121 predicted 1062
13 SASI_Hs01_00071122 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014473 predicted 901
2 SASI_Hs01_00014474 predicted 436
3 SASI_Hs01_00014475 predicted 818
4 SASI_Hs01_00014476 predicted 379
5 SASI_Hs01_00014477 predicted 726
6 SASI_Hs01_00014478 predicted 733
7 SASI_Hs01_00014479 predicted 1019
8 SASI_Hs01_00014480 predicted 601
9 SASI_Hs01_00014481 predicted 1061
10 SASI_Hs01_00014482 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249329 predicted 342
2 SASI_Rn02_00249330 predicted 795
3 SASI_Rn02_00249331 predicted 953
4 SASI_Rn02_00249332 predicted 232
5 SASI_Rn02_00249333 predicted 1140
6 SASI_Rn02_00249334 predicted 345
7 SASI_Rn02_00249335 predicted 526
8 SASI_Rn02_00249336 predicted 421
9 SASI_Rn02_00249337 predicted 910
10 SASI_Rn02_00249338 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044863 predicted 753
2 SASI_Mm01_00044864 predicted 250
3 SASI_Mm01_00044865 predicted 1648
4 SASI_Mm01_00044866 predicted 976
5 SASI_Mm02_00320029 predicted 930
6 SASI_Mm01_00044867 predicted 724
7 SASI_Mm01_00044870 predicted 1688
8 SASI_Mm01_00044871 predicted 452
9 SASI_Mm01_00044872 predicted 443
10 SASI_Mm02_00320030 predicted 369
11 SASI_Mm01_00044868 predicted 773
12 SASI_Mm01_00044869 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002751
VALIDATED
MAPK11 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 11
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002751.x-763s1c1
Sequence:CCGGCGACTACATTGACCAGCTGAACTCGAGTTCAGCTGGTCAATGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.x-424s1c1
Sequence:CCGGGAACAACATCGTCAAGTGCCACTCGAGTGGCACTTGACGATGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002751.x-894s1c1
Sequence:CCGGTGAGCAGCATCTTCCGTGGAGCTCGAGCTCCACGGAAGATGCTGCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002751.5-253s1c1
Sequence:CCGGGCGCAGAACGTACCGGGAGCTCTCGAGAGCTCCCGGTACGTTCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002751.5-822s1c1
Sequence:CCGGCCCGGACATATATCCAGTCCCCTCGAGGGGACTGGATATATGTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002751.5-637s1c1
Sequence:CCGGCATGCTCAACTGGATGCATTACTCGAGTAATGCATCCAGTTGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-434s1c1
Sequence:CCGGCACGTTCAATTCCTGGTTTACCTCGAGGTAAACCAGGAATTGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-1391s1c1
Sequence:CCGGCCTGTCCTCTTCTGGCTACTGCTCGAGCAGTAGCCAGAAGAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-1291s1c1
Sequence:CCGGGAGAATCTACACGCATGTATGCTCGAGCATACATGCGTGTAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-335s1c1
Sequence:CCGGGCCACGTCCATCGAGGACTTCCTCGAGGAAGTCCTCGATGGACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002751.5-545s1c1
Sequence:CCGGGAGCTCAGGATCCTGGATTTCCTCGAGGAAATCCAGGATCCTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-364s21c1
Sequence:CCGGGTACTTGGTGACCACCCTGATCTCGAGATCAGGGTGGTCACCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002751.5-1347s21c1
Sequence:CCGGTGTAGGAGTCTGGGCACAAGTCTCGAGACTTGTGCCCAGACTCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-289s21c1
Sequence:CCGGCCTGAAGCACGAGAACGTCATCTCGAGATGACGTTCTCGTGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-424s21c1
Sequence:CCGGGAGCGACGAGCACGTTCAATTCTCGAGAATTGAACGTGCTCGTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-393s21c1
Sequence:CCGGACCTGAACAACATCGTCAAGTCTCGAGACTTGACGATGTTGTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-1140s21c1
Sequence:CCGGAGATTGAGCAGTGAGGTGCTGCTCGAGCAGCACCTCACTGCTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-901s21c1
Sequence:CCGGCATAGACCTCCTTGGAAGGATCTCGAGATCCTTCCAAGGAGGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002751
VALIDATED
MAPK11 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 11
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002751.x-763s1c1
Sequence:CCGGCGACTACATTGACCAGCTGAACTCGAGTTCAGCTGGTCAATGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.x-424s1c1
Sequence:CCGGGAACAACATCGTCAAGTGCCACTCGAGTGGCACTTGACGATGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002751.x-894s1c1
Sequence:CCGGTGAGCAGCATCTTCCGTGGAGCTCGAGCTCCACGGAAGATGCTGCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002751.5-253s1c1
Sequence:CCGGGCGCAGAACGTACCGGGAGCTCTCGAGAGCTCCCGGTACGTTCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002751.5-822s1c1
Sequence:CCGGCCCGGACATATATCCAGTCCCCTCGAGGGGACTGGATATATGTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002751.5-637s1c1
Sequence:CCGGCATGCTCAACTGGATGCATTACTCGAGTAATGCATCCAGTTGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-434s1c1
Sequence:CCGGCACGTTCAATTCCTGGTTTACCTCGAGGTAAACCAGGAATTGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-1391s1c1
Sequence:CCGGCCTGTCCTCTTCTGGCTACTGCTCGAGCAGTAGCCAGAAGAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-1291s1c1
Sequence:CCGGGAGAATCTACACGCATGTATGCTCGAGCATACATGCGTGTAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-335s1c1
Sequence:CCGGGCCACGTCCATCGAGGACTTCCTCGAGGAAGTCCTCGATGGACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002751.5-545s1c1
Sequence:CCGGGAGCTCAGGATCCTGGATTTCCTCGAGGAAATCCAGGATCCTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-364s21c1
Sequence:CCGGGTACTTGGTGACCACCCTGATCTCGAGATCAGGGTGGTCACCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002751.5-1347s21c1
Sequence:CCGGTGTAGGAGTCTGGGCACAAGTCTCGAGACTTGTGCCCAGACTCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-289s21c1
Sequence:CCGGCCTGAAGCACGAGAACGTCATCTCGAGATGACGTTCTCGTGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-424s21c1
Sequence:CCGGGAGCGACGAGCACGTTCAATTCTCGAGAATTGAACGTGCTCGTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-393s21c1
Sequence:CCGGACCTGAACAACATCGTCAAGTCTCGAGACTTGACGATGTTGTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-1140s21c1
Sequence:CCGGAGATTGAGCAGTGAGGTGCTGCTCGAGCAGCACCTCACTGCTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-901s21c1
Sequence:CCGGCATAGACCTCCTTGGAAGGATCTCGAGATCCTTCCAAGGAGGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002751
VALIDATED
MAPK11 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 11
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002751.x-763s1c1
Sequence:CCGGCGACTACATTGACCAGCTGAACTCGAGTTCAGCTGGTCAATGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.x-424s1c1
Sequence:CCGGGAACAACATCGTCAAGTGCCACTCGAGTGGCACTTGACGATGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002751.x-894s1c1
Sequence:CCGGTGAGCAGCATCTTCCGTGGAGCTCGAGCTCCACGGAAGATGCTGCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002751.5-253s1c1
Sequence:CCGGGCGCAGAACGTACCGGGAGCTCTCGAGAGCTCCCGGTACGTTCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002751.5-822s1c1
Sequence:CCGGCCCGGACATATATCCAGTCCCCTCGAGGGGACTGGATATATGTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002751.5-637s1c1
Sequence:CCGGCATGCTCAACTGGATGCATTACTCGAGTAATGCATCCAGTTGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-434s1c1
Sequence:CCGGCACGTTCAATTCCTGGTTTACCTCGAGGTAAACCAGGAATTGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-1391s1c1
Sequence:CCGGCCTGTCCTCTTCTGGCTACTGCTCGAGCAGTAGCCAGAAGAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-1291s1c1
Sequence:CCGGGAGAATCTACACGCATGTATGCTCGAGCATACATGCGTGTAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002751.5-335s1c1
Sequence:CCGGGCCACGTCCATCGAGGACTTCCTCGAGGAAGTCCTCGATGGACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002751.5-545s1c1
Sequence:CCGGGAGCTCAGGATCCTGGATTTCCTCGAGGAAATCCAGGATCCTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-364s21c1
Sequence:CCGGGTACTTGGTGACCACCCTGATCTCGAGATCAGGGTGGTCACCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002751.5-1347s21c1
Sequence:CCGGTGTAGGAGTCTGGGCACAAGTCTCGAGACTTGTGCCCAGACTCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-289s21c1
Sequence:CCGGCCTGAAGCACGAGAACGTCATCTCGAGATGACGTTCTCGTGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-424s21c1
Sequence:CCGGGAGCGACGAGCACGTTCAATTCTCGAGAATTGAACGTGCTCGTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-393s21c1
Sequence:CCGGACCTGAACAACATCGTCAAGTCTCGAGACTTGACGATGTTGTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-1140s21c1
Sequence:CCGGAGATTGAGCAGTGAGGTGCTGCTCGAGCAGCACCTCACTGCTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002751.5-901s21c1
Sequence:CCGGCATAGACCTCCTTGGAAGGATCTCGAGATCCTTCCAAGGAGGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011161
VALIDATED
MAPK11 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 11
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-419s1c1
Sequence:CCGGGCATGTTCAATTCCTTGTCTACTCGAGTAGACAAGGAATTGAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-377s1c1
Sequence:CCGGCGACCTGAATAACATCGTCAACTCGAGTTGACGATGTTATTCAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011161.4-570s1c1
Sequence:CCGGGATGAGGAGATGACCGGATATCTCGAGATATCCGGTCATCTCCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-1117s1c1
Sequence:CCGGGCACCCATGAAATTGAGCAGTCTCGAGACTGCTCAATTTCATGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-1005s1c1
Sequence:CCGGGAGCCCTATGATGAAAGTGTTCTCGAGAACACTTTCATCATAGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-660s21c1
Sequence:CCGGGGCGCCAGAGATCATGCTAAACTCGAGTTTAGCATGATCTCTGGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011161.5-1378s21c1
Sequence:CCGGATATGCCTCCCTCCCATTATGCTCGAGCATAATGGGAGGGAGGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-326s21c1
Sequence:CCGGTGAAGCACGAGAACGTCATAGCTCGAGCTATGACGTTCTCGTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-1166s21c1
Sequence:CCGGGCACCCATGAAATTGAGCAGTCTCGAGACTGCTCAATTTCATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-1099s21c1
Sequence:CCGGGAGTGGAAGGAGCTTACTTACCTCGAGGTAAGTAAGCTCCTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011161.5-1687s21c1
Sequence:CCGGGCTGAGACCACCATCAGATTACTCGAGTAATCTGATGGTGGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011161.5-1528s21c1
Sequence:CCGGTGGATTGGGAGGAAGGCTAATCTCGAGATTAGCCTTCCTCCCAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011161
VALIDATED
MAPK11 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 11
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-419s1c1
Sequence:CCGGGCATGTTCAATTCCTTGTCTACTCGAGTAGACAAGGAATTGAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-377s1c1
Sequence:CCGGCGACCTGAATAACATCGTCAACTCGAGTTGACGATGTTATTCAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011161.4-570s1c1
Sequence:CCGGGATGAGGAGATGACCGGATATCTCGAGATATCCGGTCATCTCCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-1117s1c1
Sequence:CCGGGCACCCATGAAATTGAGCAGTCTCGAGACTGCTCAATTTCATGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-1005s1c1
Sequence:CCGGGAGCCCTATGATGAAAGTGTTCTCGAGAACACTTTCATCATAGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-660s21c1
Sequence:CCGGGGCGCCAGAGATCATGCTAAACTCGAGTTTAGCATGATCTCTGGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011161.5-1378s21c1
Sequence:CCGGATATGCCTCCCTCCCATTATGCTCGAGCATAATGGGAGGGAGGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-326s21c1
Sequence:CCGGTGAAGCACGAGAACGTCATAGCTCGAGCTATGACGTTCTCGTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-1166s21c1
Sequence:CCGGGCACCCATGAAATTGAGCAGTCTCGAGACTGCTCAATTTCATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-1099s21c1
Sequence:CCGGGAGTGGAAGGAGCTTACTTACCTCGAGGTAAGTAAGCTCCTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011161.5-1687s21c1
Sequence:CCGGGCTGAGACCACCATCAGATTACTCGAGTAATCTGATGGTGGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011161.5-1528s21c1
Sequence:CCGGTGGATTGGGAGGAAGGCTAATCTCGAGATTAGCCTTCCTCCCAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011161
VALIDATED
MAPK11 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 11
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-419s1c1
Sequence:CCGGGCATGTTCAATTCCTTGTCTACTCGAGTAGACAAGGAATTGAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-377s1c1
Sequence:CCGGCGACCTGAATAACATCGTCAACTCGAGTTGACGATGTTATTCAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011161.4-570s1c1
Sequence:CCGGGATGAGGAGATGACCGGATATCTCGAGATATCCGGTCATCTCCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-1117s1c1
Sequence:CCGGGCACCCATGAAATTGAGCAGTCTCGAGACTGCTCAATTTCATGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011161.4-1005s1c1
Sequence:CCGGGAGCCCTATGATGAAAGTGTTCTCGAGAACACTTTCATCATAGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-660s21c1
Sequence:CCGGGGCGCCAGAGATCATGCTAAACTCGAGTTTAGCATGATCTCTGGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011161.5-1378s21c1
Sequence:CCGGATATGCCTCCCTCCCATTATGCTCGAGCATAATGGGAGGGAGGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-326s21c1
Sequence:CCGGTGAAGCACGAGAACGTCATAGCTCGAGCTATGACGTTCTCGTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-1166s21c1
Sequence:CCGGGCACCCATGAAATTGAGCAGTCTCGAGACTGCTCAATTTCATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011161.5-1099s21c1
Sequence:CCGGGAGTGGAAGGAGCTTACTTACCTCGAGGTAAGTAAGCTCCTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011161.5-1687s21c1
Sequence:CCGGGCTGAGACCACCATCAGATTACTCGAGTAATCTGATGGTGGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011161.5-1528s21c1
Sequence:CCGGTGGATTGGGAGGAAGGCTAATCTCGAGATTAGCCTTCCTCCCAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks