EMAIL THIS PAGE TO A FRIEND

MAPK14

mitogen-activated protein kinase 14

Synonyms: CSBP CSBP1 CSBP2 CSPB1 EXIP Mxi2 PRKM14 PRKM15 RK SAPK2A p38 p38ALPHA
Gene ID:
Human(1432) Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with this kinase. The substrates of this kinase include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of this kinase in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. Four alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(26416) mitogen-activated protein kinase 14
Rat(81649) mitogen activated protein kinase 14
Domestic Rabbit(100341695) mitogen-activated protein kinase 14
naked mole-rat(101715692) mitogen-activated protein kinase 14
domestic guinea pig(100723285) mitogen-activated protein kinase 14
sheep(100217411) mitogen-activated protein kinase 14
chicken(421183) mitogen-activated protein kinase 14
cow(534492) mitogen-activated protein kinase 14
Horse(100063532) mitogen-activated protein kinase 14
domestic cat(101101135) mitogen-activated protein kinase 14
dog(403856) mitogen-activated protein kinase 14
269 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M1697 Anti-MAPK14 (13-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M1822 Anti-MAPK14 (318-330) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300499 Anti-MAPK14 (Ab-182) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB1405665 Anti-MAPK14 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV06004 Anti-MAPK14 antibody produced in rabbit affinity isolated antibody canine, rat, mouse, bovine, human,
immunohistochemistry, western blot pricing
HPA051825 Anti-MAPK14 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5200096 Anti-MAPK14 antibody produced in rabbit whole antiserum pig, canine, hamster, sheep, rabbit, rat, mouse, bovine, chicken, human, guinea pig, monkey
immunohistochemistry, immunoprecipitation, western blot pricing
SAB4500491 Anti-p38 MAPK antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4500492 Anti-p38 MAPK antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500493 Anti-p38 MAPK antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500490 Anti-p38 MAPK, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4300200 Anti-phospho-MAPK14 (pThr180) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4300201 Anti-phospho-MAPK14 (pTyr182) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
P1491 Anti-phospho-p38 (pThr180/pTyr182) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, monkey, rat, mouse, carp, canine
immunohistochemistry, western blot pricing
SAB4504095 Anti-phospho-p38 MAPK (pThr179+Tyr181) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4504497 Anti-phospho-p38 MAPK (pThr180) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504498 Anti-phospho-p38 MAPK (pTyr182) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504094 Anti-phospho-p38 MAPK (pTyr322) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301534 Anti-phospho-p38 MAPK (pTyr322) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
GW21175B Anti-RK antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
WH0001432M1 Monoclonal Anti-MAPK14 antibody produced in mouse clone 3D5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403701 Monoclonal Anti-MAPK14, (C-terminal) antibody produced in mouse clone 3D5, ascites fluid human
ELISA, western blot pricing
M8177 Monoclonal Anti-p38 MAP Kinase, Activated (Diphosphorylated p38) antibody produced in mouse ~2 mg/mL, clone P38-TY, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139012 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001315 siRNAs that have been validated in the lab human pricing
NM_139012 Rosetta Predictions human pricing
NM_139013 Rosetta Predictions human pricing
NM_139014 Rosetta Predictions human pricing
NM_031020 Rosetta Predictions rat pricing
NM_011951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001315 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018467 validated 769
1 SASI_Hs01_00018465 validated 537
1 SASI_Hs01_00018464 validated 784
2 SASI_Hs02_00331604 predicted 812
3 SASI_Hs01_00018466 predicted 565
4 SASI_Hs02_00331605 predicted 716
5 SASI_Hs01_00018468 predicted 758
6 SASI_Hs01_00018469 predicted 818
7 SASI_Hs01_00018470 predicted 573
8 SASI_Hs01_00018471 predicted 732
9 SASI_Hs01_00018472 predicted 534
10 SASI_Hs01_00018473 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027001 predicted 790
2 SASI_Hs01_00027002 predicted 533
3 SASI_Hs02_00364052 predicted 818
4 SASI_Hs01_00027003 predicted 566
5 SASI_Hs01_00027004 predicted 761
6 SASI_Hs02_00364053 predicted 714
7 SASI_Hs01_00027005 predicted 754
8 SASI_Hs01_00027006 predicted 822
9 SASI_Hs01_00027007 predicted 578
10 SASI_Hs01_00027008 predicted 736
11 SASI_Hs01_00027009 predicted 540
12 SASI_Hs01_00027010 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227799 predicted 786
2 SASI_Hs01_00227800 predicted 533
3 SASI_Hs02_00364054 predicted 818
4 SASI_Hs01_00227801 predicted 568
5 SASI_Hs01_00227802 predicted 768
6 SASI_Hs02_00364055 predicted 713
7 SASI_Hs01_00227803 predicted 749
8 SASI_Hs01_00227804 predicted 821
9 SASI_Hs01_00227805 predicted 579
10 SASI_Hs01_00227806 predicted 728
11 SASI_Hs01_00227807 predicted 539
12 SASI_Hs01_00227808 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055752 predicted 792
2 SASI_Hs01_00055753 predicted 541
3 SASI_Hs02_00364056 predicted 815
4 SASI_Hs01_00055754 predicted 568
5 SASI_Hs01_00055755 predicted 768
6 SASI_Hs02_00364057 predicted 715
7 SASI_Hs01_00055756 predicted 752
8 SASI_Hs01_00055757 predicted 821
9 SASI_Hs01_00055758 predicted 575
10 SASI_Hs01_00055759 predicted 730
11 SASI_Hs01_00055760 predicted 533
12 SASI_Hs01_00055761 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058108 predicted 725
2 SASI_Rn01_00058109 predicted 1458
3 SASI_Rn01_00058110 predicted 1260
4 SASI_Rn01_00058111 predicted 467
5 SASI_Rn01_00058112 predicted 1098
6 SASI_Rn01_00058113 predicted 1326
7 SASI_Rn01_00058114 predicted 870
8 SASI_Rn01_00058115 predicted 1065
9 SASI_Rn01_00058116 predicted 1102
10 SASI_Rn01_00058117 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020743 predicted 1252
2 SASI_Mm01_00020744 predicted 463
3 SASI_Mm01_00020745 predicted 874
4 SASI_Mm01_00020746 predicted 720
5 SASI_Mm01_00020747 predicted 1091
6 SASI_Mm01_00020748 predicted 811
7 SASI_Mm01_00020749 predicted 1250
8 SASI_Mm01_00020750 predicted 939
9 SASI_Mm01_00020751 predicted 741
10 SASI_Mm01_00020752 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011951
VALIDATED
MAPK14 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 14
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-1462s21c1
Sequence:CCGGCCTCTTGTTGAAAGATTCCTTCTCGAGAAGGAATCTTTCAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-945s21c1
Sequence:CCGGTGACCGGAAGAACGTTGTTTCCTCGAGGAAACAACGTTCTTCCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-3167s21c1
Sequence:CCGGCCAACAATTCTGCTCTGGTTACTCGAGTAACCAGAGCAGAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-465s21c1
Sequence:CCGGGACCGTTTCAGTCCATCATTCCTCGAGGAATGATGGACTGAAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-877s21c1
Sequence:CCGGGCTGAATTGGATGCACTATAACTCGAGTTATAGTGCATCCAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1463s1c1
Sequence:CCGGCCTCTTGTTGAAAGATTCCTTCTCGAGAAGGAATCTTTCAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1313s1c1
Sequence:CCGGCCTGACCTATGATGAAGTCATCTCGAGATGACTTCATCATAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-974s1c1
Sequence:CCGGAGACCATATTGATCAGTTGAACTCGAGTTCAACTGATCAATATGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1053s1c1
Sequence:CCGGGAGTCTGCAAGAAACTACATTCTCGAGAATGTAGTTTCTTGCAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-3168s1c1
Sequence:CCGGCCAACAATTCTGCTCTGGTTACTCGAGTAACCAGAGCAGAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1049s1c1
Sequence:CCGGCTCAGAGTCTGCAAGAAACTACTCGAGTAGTTTCTTGCAGACTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1052s1c1
Sequence:CCGGAGAGTCTGCAAGAAACTACATCTCGAGATGTAGTTTCTTGCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-702s1c1
Sequence:CCGGCGAGGGCTGAAGTATATACATCTCGAGATGTATATACTTCAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1055s1c1
Sequence:CCGGGTCTGCAAGAAACTACATTCACTCGAGTGAATGTAGTTTCTTGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011951
VALIDATED
MAPK14 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 14
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-1462s21c1
Sequence:CCGGCCTCTTGTTGAAAGATTCCTTCTCGAGAAGGAATCTTTCAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-945s21c1
Sequence:CCGGTGACCGGAAGAACGTTGTTTCCTCGAGGAAACAACGTTCTTCCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-3167s21c1
Sequence:CCGGCCAACAATTCTGCTCTGGTTACTCGAGTAACCAGAGCAGAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-465s21c1
Sequence:CCGGGACCGTTTCAGTCCATCATTCCTCGAGGAATGATGGACTGAAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-877s21c1
Sequence:CCGGGCTGAATTGGATGCACTATAACTCGAGTTATAGTGCATCCAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1463s1c1
Sequence:CCGGCCTCTTGTTGAAAGATTCCTTCTCGAGAAGGAATCTTTCAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1313s1c1
Sequence:CCGGCCTGACCTATGATGAAGTCATCTCGAGATGACTTCATCATAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-974s1c1
Sequence:CCGGAGACCATATTGATCAGTTGAACTCGAGTTCAACTGATCAATATGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1053s1c1
Sequence:CCGGGAGTCTGCAAGAAACTACATTCTCGAGAATGTAGTTTCTTGCAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-3168s1c1
Sequence:CCGGCCAACAATTCTGCTCTGGTTACTCGAGTAACCAGAGCAGAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1049s1c1
Sequence:CCGGCTCAGAGTCTGCAAGAAACTACTCGAGTAGTTTCTTGCAGACTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1052s1c1
Sequence:CCGGAGAGTCTGCAAGAAACTACATCTCGAGATGTAGTTTCTTGCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-702s1c1
Sequence:CCGGCGAGGGCTGAAGTATATACATCTCGAGATGTATATACTTCAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1055s1c1
Sequence:CCGGGTCTGCAAGAAACTACATTCACTCGAGTGAATGTAGTTTCTTGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011951
VALIDATED
MAPK14 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 14
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-1462s21c1
Sequence:CCGGCCTCTTGTTGAAAGATTCCTTCTCGAGAAGGAATCTTTCAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-945s21c1
Sequence:CCGGTGACCGGAAGAACGTTGTTTCCTCGAGGAAACAACGTTCTTCCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-3167s21c1
Sequence:CCGGCCAACAATTCTGCTCTGGTTACTCGAGTAACCAGAGCAGAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-465s21c1
Sequence:CCGGGACCGTTTCAGTCCATCATTCCTCGAGGAATGATGGACTGAAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011951.2-877s21c1
Sequence:CCGGGCTGAATTGGATGCACTATAACTCGAGTTATAGTGCATCCAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1463s1c1
Sequence:CCGGCCTCTTGTTGAAAGATTCCTTCTCGAGAAGGAATCTTTCAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1313s1c1
Sequence:CCGGCCTGACCTATGATGAAGTCATCTCGAGATGACTTCATCATAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-974s1c1
Sequence:CCGGAGACCATATTGATCAGTTGAACTCGAGTTCAACTGATCAATATGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1053s1c1
Sequence:CCGGGAGTCTGCAAGAAACTACATTCTCGAGAATGTAGTTTCTTGCAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-3168s1c1
Sequence:CCGGCCAACAATTCTGCTCTGGTTACTCGAGTAACCAGAGCAGAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1049s1c1
Sequence:CCGGCTCAGAGTCTGCAAGAAACTACTCGAGTAGTTTCTTGCAGACTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1052s1c1
Sequence:CCGGAGAGTCTGCAAGAAACTACATCTCGAGATGTAGTTTCTTGCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-702s1c1
Sequence:CCGGCGAGGGCTGAAGTATATACATCTCGAGATGTATATACTTCAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011951.1-1055s1c1
Sequence:CCGGGTCTGCAAGAAACTACATTCACTCGAGTGAATGTAGTTTCTTGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001315
VALIDATED
MAPK14 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 14
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001315.1-2333s1c1
Sequence:CCGGGTACTTCCTGTGTACTCTTTACTCGAGTAAAGAGTACACAGGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001315.1-578s1c1
Sequence:CCGGGCGGTTACTTAAACATATGAACTCGAGTTCATATGTTTAAGTAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001315.1-819s1c1
Sequence:CCGGCCTAGTAATCTAGCTGTGAATCTCGAGATTCACAGCTAGATTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001315.1-3584s1c1
Sequence:CCGGCTTCGGTTTCTGAGCATAATGCTCGAGCATTATGCTCAGAAACCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001315.x-768s1c1
Sequence:CCGGCGAGGTCTAAAGTATATACATCTCGAGATGTATATACTTTAGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001315.x-1118s1c1
Sequence:CCGGCCATGAGGCAAGAAACTATATCTCGAGATATAGTTTCTTGCCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001315.x-737s1c1
Sequence:CCGGCCATGTTCAGTTCCTTATCTACTCGAGTAGATAAGGAACTGAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001315
VALIDATED
MAPK14 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 14
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001315.1-2333s1c1
Sequence:CCGGGTACTTCCTGTGTACTCTTTACTCGAGTAAAGAGTACACAGGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001315.1-578s1c1
Sequence:CCGGGCGGTTACTTAAACATATGAACTCGAGTTCATATGTTTAAGTAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001315.1-819s1c1
Sequence:CCGGCCTAGTAATCTAGCTGTGAATCTCGAGATTCACAGCTAGATTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001315.1-3584s1c1
Sequence:CCGGCTTCGGTTTCTGAGCATAATGCTCGAGCATTATGCTCAGAAACCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001315.x-768s1c1
Sequence:CCGGCGAGGTCTAAAGTATATACATCTCGAGATGTATATACTTTAGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001315.x-1118s1c1
Sequence:CCGGCCATGAGGCAAGAAACTATATCTCGAGATATAGTTTCTTGCCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001315.x-737s1c1
Sequence:CCGGCCATGTTCAGTTCCTTATCTACTCGAGTAGATAAGGAACTGAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001315
VALIDATED
MAPK14 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 14
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001315.1-2333s1c1
Sequence:CCGGGTACTTCCTGTGTACTCTTTACTCGAGTAAAGAGTACACAGGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001315.1-578s1c1
Sequence:CCGGGCGGTTACTTAAACATATGAACTCGAGTTCATATGTTTAAGTAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001315.1-819s1c1
Sequence:CCGGCCTAGTAATCTAGCTGTGAATCTCGAGATTCACAGCTAGATTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001315.1-3584s1c1
Sequence:CCGGCTTCGGTTTCTGAGCATAATGCTCGAGCATTATGCTCAGAAACCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001315.x-768s1c1
Sequence:CCGGCGAGGTCTAAAGTATATACATCTCGAGATGTATATACTTTAGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001315.x-1118s1c1
Sequence:CCGGCCATGAGGCAAGAAACTATATCTCGAGATATAGTTTCTTGCCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001315.x-737s1c1
Sequence:CCGGCCATGTTCAGTTCCTTATCTACTCGAGTAGATAAGGAACTGAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139012
VALIDATED
MAPK14 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 14
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000010052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139012.x-741s1c1
Sequence:CCGGGTTCAGTTCCTTATCTACCAACTCGAGTTGGTAGATAAGGAACTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139012.x-877s1c1
Sequence:CCGGCTCGGCACACAGATGATGAAACTCGAGTTTCATCATCTGTGTGCCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139012.x-795s1c1
Sequence:CCGGGACATAATTCACAGGGACCTACTCGAGTAGGTCCCTGTGAATTATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139012
VALIDATED
MAPK14 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 14
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000010052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139012.x-741s1c1
Sequence:CCGGGTTCAGTTCCTTATCTACCAACTCGAGTTGGTAGATAAGGAACTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139012.x-877s1c1
Sequence:CCGGCTCGGCACACAGATGATGAAACTCGAGTTTCATCATCTGTGTGCCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139012.x-795s1c1
Sequence:CCGGGACATAATTCACAGGGACCTACTCGAGTAGGTCCCTGTGAATTATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139012
VALIDATED
MAPK14 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 14
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000010052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139012.x-741s1c1
Sequence:CCGGGTTCAGTTCCTTATCTACCAACTCGAGTTGGTAGATAAGGAACTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139012.x-877s1c1
Sequence:CCGGCTCGGCACACAGATGATGAAACTCGAGTTTCATCATCTGTGTGCCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139012.x-795s1c1
Sequence:CCGGGACATAATTCACAGGGACCTACTCGAGTAGGTCCCTGTGAATTATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks