EMAIL THIS PAGE TO A FRIEND

MAPK8IP1

mitogen-activated protein kinase 8 interacting protein 1

Synonyms: IB1 JIP-1 JIP1 PRKM8IP
UniProtKB ID: Q9UQF2, D3DQP4, O43407
Gene ID:
Human(9479) Summary: This gene encodes a regulator of the pancreatic beta-cell function. It is highly similar to JIP-1, a mouse protein known to be a regulator of c-Jun amino-terminal kinase (Mapk8). This protein has been shown to prevent MAPK8 mediated activation of transcription factors, and to decrease IL-1 beta and MAP kinase kinase 1 (MEKK1) induced apoptosis in pancreatic beta cells. This protein also functions as a DNA-binding transactivator of the glucose transporter GLUT2. RE1-silencing transcription factor (REST) is reported to repress the expression of this gene in insulin-secreting beta cells. This gene is found to be mutated in a type 2 diabetes family, and thus is thought to be a susceptibility gene for type 2 diabetes. [provided by RefSeq, May 2011]
Mouse(19099) mitogen-activated protein kinase 8 interacting protein 1
Rat(116457) mitogen-activated protein kinase 8 interacting protein 1
chicken(423202) mitogen-activated protein kinase 8 interacting protein 1
cow(524806) mitogen-activated protein kinase 8 interacting protein 1
Horse(100056764) mitogen-activated protein kinase 8 interacting protein 1
domestic cat(101085070) mitogen-activated protein kinase 8 interacting protein 1
dog(483640) mitogen-activated protein kinase 8 interacting protein 1
sheep(101116934) mitogen-activated protein kinase 8 interacting protein 1
domestic guinea pig(100725179) mitogen-activated protein kinase 8 interacting protein 1
naked mole-rat(101705667) mitogen-activated protein kinase 8 interacting protein 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005456 Rosetta Predictions human pricing
NM_053777 Rosetta Predictions rat pricing
NM_011162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140017 predicted 1535
2 SASI_Hs01_00140018 predicted 1292
3 SASI_Hs01_00140019 predicted 1779
4 SASI_Hs01_00140020 predicted 2232
5 SASI_Hs01_00140021 predicted 982
6 SASI_Hs01_00140026 predicted 260
7 SASI_Hs02_00339616 predicted 257
8 SASI_Hs02_00339617 predicted 298
9 SASI_Hs01_00140022 predicted 2474
10 SASI_Hs01_00140023 predicted 2477
11 SASI_Hs01_00140024 predicted 2476
12 SASI_Hs01_00140025 predicted 2488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111877 predicted 2134
2 SASI_Rn01_00111878 predicted 1665
3 SASI_Rn01_00111880 predicted 2139
4 SASI_Rn01_00111881 predicted 1748
5 SASI_Rn01_00111882 predicted 1802
6 SASI_Rn01_00111883 predicted 1643
7 SASI_Rn02_00266582 predicted 1665
8 SASI_Rn02_00266583 predicted 1746
9 SASI_Rn01_00111884 predicted 706
10 SASI_Rn01_00111885 predicted 2028
11 SASI_Rn01_00111876 predicted 1552
12 SASI_Rn01_00111879 predicted 2118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320031 predicted 1309
2 SASI_Mm01_00127027 predicted 1980
3 SASI_Mm01_00127028 predicted 1616
4 SASI_Mm01_00127029 predicted 1688
5 SASI_Mm01_00127030 predicted 1479
6 SASI_Mm01_00127031 predicted 1741
7 SASI_Mm01_00127032 predicted 2061
8 SASI_Mm01_00127033 predicted 1586
9 SASI_Mm01_00127034 predicted 1968
10 SASI_Mm02_00320032 predicted 1043
11 SASI_Mm01_00127035 predicted 1050
12 SASI_Mm01_00127036 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005456
VALIDATED
MAPK8IP1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 8 interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005456.x-1601s1c1
Sequence:CCGGCGGGCTGTTCTCCTGCATCATCTCGAGATGATGCAGGAGAACAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005456.x-261s1c1
Sequence:CCGGCCCAATTTCAGGCTCACCCATCTCGAGATGGGTGAGCCTGAAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005456.x-1784s1c1
Sequence:CCGGCTTTCCTGCCTATTACGCCATCTCGAGATGGCGTAATAGGCAGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005456.x-1442s1c1
Sequence:CCGGGTCGGCCATCGGAGAGGAATACTCGAGTATTCCTCTCCGATGGCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-1295s21c1
Sequence:CCGGCTATGACTCTGTCAAGTACACCTCGAGGTGTACTTGACAGAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-1601s21c1
Sequence:CCGGCGGGCTGTTCTCCTGCATCATCTCGAGATGATGCAGGAGAACAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-307s21c1
Sequence:CCGGATGAAGACCTCTCGGAGATCACTCGAGTGATCTCCGAGAGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005456.2-283s21c1
Sequence:CCGGACATCAGCCTGGAGGAGTTTGCTCGAGCAAACTCCTCCAGGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-331s21c1
Sequence:CCGGATGAGTGTGGCATCAGCTTACCTCGAGGTAAGCTGATGCCACACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005456
VALIDATED
MAPK8IP1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 8 interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005456.x-1601s1c1
Sequence:CCGGCGGGCTGTTCTCCTGCATCATCTCGAGATGATGCAGGAGAACAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005456.x-261s1c1
Sequence:CCGGCCCAATTTCAGGCTCACCCATCTCGAGATGGGTGAGCCTGAAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005456.x-1784s1c1
Sequence:CCGGCTTTCCTGCCTATTACGCCATCTCGAGATGGCGTAATAGGCAGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005456.x-1442s1c1
Sequence:CCGGGTCGGCCATCGGAGAGGAATACTCGAGTATTCCTCTCCGATGGCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-1295s21c1
Sequence:CCGGCTATGACTCTGTCAAGTACACCTCGAGGTGTACTTGACAGAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-1601s21c1
Sequence:CCGGCGGGCTGTTCTCCTGCATCATCTCGAGATGATGCAGGAGAACAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-307s21c1
Sequence:CCGGATGAAGACCTCTCGGAGATCACTCGAGTGATCTCCGAGAGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005456.2-283s21c1
Sequence:CCGGACATCAGCCTGGAGGAGTTTGCTCGAGCAAACTCCTCCAGGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-331s21c1
Sequence:CCGGATGAGTGTGGCATCAGCTTACCTCGAGGTAAGCTGATGCCACACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005456
VALIDATED
MAPK8IP1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 8 interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005456.x-1601s1c1
Sequence:CCGGCGGGCTGTTCTCCTGCATCATCTCGAGATGATGCAGGAGAACAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005456.x-261s1c1
Sequence:CCGGCCCAATTTCAGGCTCACCCATCTCGAGATGGGTGAGCCTGAAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005456.x-1784s1c1
Sequence:CCGGCTTTCCTGCCTATTACGCCATCTCGAGATGGCGTAATAGGCAGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005456.x-1442s1c1
Sequence:CCGGGTCGGCCATCGGAGAGGAATACTCGAGTATTCCTCTCCGATGGCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-1295s21c1
Sequence:CCGGCTATGACTCTGTCAAGTACACCTCGAGGTGTACTTGACAGAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-1601s21c1
Sequence:CCGGCGGGCTGTTCTCCTGCATCATCTCGAGATGATGCAGGAGAACAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-307s21c1
Sequence:CCGGATGAAGACCTCTCGGAGATCACTCGAGTGATCTCCGAGAGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005456.2-283s21c1
Sequence:CCGGACATCAGCCTGGAGGAGTTTGCTCGAGCAAACTCCTCCAGGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005456.2-331s21c1
Sequence:CCGGATGAGTGTGGCATCAGCTTACCTCGAGGTAAGCTGATGCCACACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011162
VALIDATED
MAPK8IP1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 8 interacting protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011162.2-2398s1c1
Sequence:CCGGGCAGATGCAGTTTATTGTAATCTCGAGATTACAATAAACTGCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011162.2-650s1c1
Sequence:CCGGCACGCTGAATAATAACTCTTTCTCGAGAAAGAGTTATTATTCAGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011162.2-2148s1c1
Sequence:CCGGGTGTCTGAAGATTCCACCAAACTCGAGTTTGGTGGAATCTTCAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011162.2-2072s1c1
Sequence:CCGGCCATCCAAAGAATAACAAGTACTCGAGTACTTGTTATTCTTTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011162.4-640s21c1
Sequence:CCGGGGTCTCAGGACACGCTGAATACTCGAGTATTCAGCGTGTCCTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011162.4-1694s21c1
Sequence:CCGGCTATTGGTATGAGGCCTATAACTCGAGTTATAGGCCTCATACCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011162.4-1595s21c1
Sequence:CCGGGCAAACCCATCGGGCTATATTCTCGAGAATATAGCCCGATGGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011162
VALIDATED
MAPK8IP1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 8 interacting protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011162.2-2398s1c1
Sequence:CCGGGCAGATGCAGTTTATTGTAATCTCGAGATTACAATAAACTGCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011162.2-650s1c1
Sequence:CCGGCACGCTGAATAATAACTCTTTCTCGAGAAAGAGTTATTATTCAGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011162.2-2148s1c1
Sequence:CCGGGTGTCTGAAGATTCCACCAAACTCGAGTTTGGTGGAATCTTCAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011162.2-2072s1c1
Sequence:CCGGCCATCCAAAGAATAACAAGTACTCGAGTACTTGTTATTCTTTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011162.4-640s21c1
Sequence:CCGGGGTCTCAGGACACGCTGAATACTCGAGTATTCAGCGTGTCCTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011162.4-1694s21c1
Sequence:CCGGCTATTGGTATGAGGCCTATAACTCGAGTTATAGGCCTCATACCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011162.4-1595s21c1
Sequence:CCGGGCAAACCCATCGGGCTATATTCTCGAGAATATAGCCCGATGGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011162
VALIDATED
MAPK8IP1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 8 interacting protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011162.2-2398s1c1
Sequence:CCGGGCAGATGCAGTTTATTGTAATCTCGAGATTACAATAAACTGCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011162.2-650s1c1
Sequence:CCGGCACGCTGAATAATAACTCTTTCTCGAGAAAGAGTTATTATTCAGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011162.2-2148s1c1
Sequence:CCGGGTGTCTGAAGATTCCACCAAACTCGAGTTTGGTGGAATCTTCAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011162.2-2072s1c1
Sequence:CCGGCCATCCAAAGAATAACAAGTACTCGAGTACTTGTTATTCTTTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011162.4-640s21c1
Sequence:CCGGGGTCTCAGGACACGCTGAATACTCGAGTATTCAGCGTGTCCTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011162.4-1694s21c1
Sequence:CCGGCTATTGGTATGAGGCCTATAACTCGAGTTATAGGCCTCATACCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011162.4-1595s21c1
Sequence:CCGGGCAAACCCATCGGGCTATATTCTCGAGAATATAGCCCGATGGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks