EMAIL THIS PAGE TO A FRIEND

MARCH2

membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase

Synonyms: MARCH-II RNF172
UniProtKB ID: Q9P0N8, A6NP10, Q5H785, Q8N5A3, Q96B78
Gene ID:
Human(51257) Summary: MARCH2 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH2 reduces surface accumulation of several glycoproteins and appears to regulate early endosome-to-trans-Golgi network (TGN) trafficking (Bartee et al., 2004 [PubMed 14722266]
Mouse(224703) membrane-associated ring finger (C3HC4) 2
Rat(362849) membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
domestic guinea pig(100733733) membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
naked mole-rat(101720054) membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
sheep(101103806) membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
Zebrafish(555611) membrane-associated ring finger (C3HC4) 2
chicken(420062) membrane-associated ring finger (C3HC4) 2
dog(611624) membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
cow(508949) membrane-associated ring finger (C3HC4) 2
domestic cat(101090087) membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036831 MISSION® esiRNA esiRNA human MARCH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005415 Rosetta Predictions human pricing
NM_001005416 Rosetta Predictions human pricing
NM_016496 Rosetta Predictions human pricing
NM_001012196 Rosetta Predictions rat pricing
NM_001034108 Rosetta Predictions rat pricing
NM_145486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163385 predicted 1054
2 SASI_Hs01_00163387 predicted 585
3 SASI_Hs01_00163388 predicted 1252
4 SASI_Hs01_00163389 predicted 1230
5 SASI_Hs01_00163390 predicted 768
6 SASI_Hs01_00163391 predicted 1166
7 SASI_Hs01_00163392 predicted 272
8 SASI_Hs02_00304919 predicted 987
9 SASI_Hs01_00163393 predicted 756
10 SASI_Hs01_00163394 predicted 959
11 SASI_Hs01_00163386 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019492 predicted 840
2 SASI_Hs01_00019493 predicted 1040
3 SASI_Hs02_00304920 predicted 1013
4 SASI_Hs01_00019495 predicted 958
5 SASI_Hs01_00019496 predicted 266
6 SASI_Hs01_00019497 predicted 805
7 SASI_Hs02_00304921 predicted 776
8 SASI_Hs01_00019498 predicted 550
9 SASI_Hs01_00019499 predicted 746
10 SASI_Hs01_00019500 predicted 535
11 SASI_Hs01_00019494 predicted 561
12 SASI_Hs01_00019501 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057573 predicted 581
2 SASI_Hs01_00057574 predicted 1320
3 SASI_Hs01_00057576 predicted 859
4 SASI_Hs01_00057577 predicted 1519
5 SASI_Hs01_00057578 predicted 1500
6 SASI_Hs01_00057579 predicted 1042
7 SASI_Hs01_00057580 predicted 1439
8 SASI_Hs01_00057581 predicted 534
9 SASI_Hs02_00349561 predicted 1256
10 SASI_Hs01_00057582 predicted 1030
11 SASI_Hs01_00057575 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032531 predicted 477
2 SASI_Rn01_00032532 predicted 575
3 SASI_Rn01_00032533 predicted 568
4 SASI_Rn01_00032534 predicted 697
5 SASI_Rn01_00032535 predicted 456
6 SASI_Rn01_00032536 predicted 483
7 SASI_Rn01_00032537 predicted 735
8 SASI_Rn01_00032538 predicted 234
9 SASI_Rn01_00032539 predicted 305
10 SASI_Rn01_00032540 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064754 predicted 1032
2 SASI_Rn02_00203942 predicted 486
3 SASI_Rn01_00064755 predicted 663
4 SASI_Rn02_00203943 predicted 233
5 SASI_Rn02_00203944 predicted 500
6 SASI_Rn02_00203945 predicted 502
7 SASI_Rn02_00203946 predicted 253
8 SASI_Rn02_00203947 predicted 266
9 SASI_Rn02_00203948 predicted 385
10 SASI_Rn01_00064759 predicted 890
11 SASI_Rn01_00064756 predicted 765
12 SASI_Rn01_00064757 predicted 1033
13 SASI_Rn01_00064758 predicted 765
14 SASI_Rn01_00064760 predicted 1002
15 SASI_Rn01_00064761 predicted 963
16 SASI_Rn01_00064762 predicted 659
17 SASI_Rn01_00064763 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340895 predicted 760
2 SASI_Mm02_00340896 predicted 321
3 SASI_Mm02_00340897 predicted 595
4 SASI_Mm02_00340898 predicted 1229
5 SASI_Mm02_00340899 predicted 1229
6 SASI_Mm02_00340900 predicted 757
7 SASI_Mm02_00340901 predicted 1110
8 SASI_Mm02_00340902 predicted 807
9 SASI_Mm02_00340903 predicted 1056
10 SASI_Mm02_00340904 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016496
MARCH2 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-1088s1c1
Sequence:CCGGCCAGAAAGTTCGCCTGAAGATCTCGAGATCTTCAGGCGAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-722s1c1
Sequence:CCGGGCATAAGAGCTGTCTGGAGAACTCGAGTTCTCCAGACAGCTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-860s1c1
Sequence:CCGGGCGGACACTGTGCTGCGACATCTCGAGATGTCGCAGCACAGTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-590s1c1
Sequence:CCGGCCGGCTCCTCTCCACCGTCATCTCGAGATGACGGTGGAGAGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016496.4-1501s21c1
Sequence:CCGGGCGCCCTTAAAGCTGGAACATCTCGAGATGTTCCAGCTTTAAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016496.4-1525s21c1
Sequence:CCGGAGCAAGCTTCTTGCGCTTCTCCTCGAGGAGAAGCGCAAGAAGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016496.4-989s21c1
Sequence:CCGGTCGCCCTCTTCACCATCTATGCTCGAGCATAGATGGTGAAGAGGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016496.4-1048s21c1
Sequence:CCGGCTGTACTCCGAGTGGAGAAAGCTCGAGCTTTCTCCACTCGGAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016496
MARCH2 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-1088s1c1
Sequence:CCGGCCAGAAAGTTCGCCTGAAGATCTCGAGATCTTCAGGCGAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-722s1c1
Sequence:CCGGGCATAAGAGCTGTCTGGAGAACTCGAGTTCTCCAGACAGCTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-860s1c1
Sequence:CCGGGCGGACACTGTGCTGCGACATCTCGAGATGTCGCAGCACAGTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-590s1c1
Sequence:CCGGCCGGCTCCTCTCCACCGTCATCTCGAGATGACGGTGGAGAGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016496.4-1501s21c1
Sequence:CCGGGCGCCCTTAAAGCTGGAACATCTCGAGATGTTCCAGCTTTAAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016496.4-1525s21c1
Sequence:CCGGAGCAAGCTTCTTGCGCTTCTCCTCGAGGAGAAGCGCAAGAAGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016496.4-989s21c1
Sequence:CCGGTCGCCCTCTTCACCATCTATGCTCGAGCATAGATGGTGAAGAGGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016496.4-1048s21c1
Sequence:CCGGCTGTACTCCGAGTGGAGAAAGCTCGAGCTTTCTCCACTCGGAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016496
MARCH2 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-1088s1c1
Sequence:CCGGCCAGAAAGTTCGCCTGAAGATCTCGAGATCTTCAGGCGAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-722s1c1
Sequence:CCGGGCATAAGAGCTGTCTGGAGAACTCGAGTTCTCCAGACAGCTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-860s1c1
Sequence:CCGGGCGGACACTGTGCTGCGACATCTCGAGATGTCGCAGCACAGTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016496.3-590s1c1
Sequence:CCGGCCGGCTCCTCTCCACCGTCATCTCGAGATGACGGTGGAGAGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016496.4-1501s21c1
Sequence:CCGGGCGCCCTTAAAGCTGGAACATCTCGAGATGTTCCAGCTTTAAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016496.4-1525s21c1
Sequence:CCGGAGCAAGCTTCTTGCGCTTCTCCTCGAGGAGAAGCGCAAGAAGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016496.4-989s21c1
Sequence:CCGGTCGCCCTCTTCACCATCTATGCTCGAGCATAGATGGTGAAGAGGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016496.4-1048s21c1
Sequence:CCGGCTGTACTCCGAGTGGAGAAAGCTCGAGCTTTCTCCACTCGGAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145486
VALIDATED
MARCH2 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145486.2-2577s1c1
Sequence:CCGGGCCAAGTTTGACACCCTAAATCTCGAGATTTAGGGTGTCAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145486.2-870s1c1
Sequence:CCGGGCTGGCTACTGGACTCTTAAACTCGAGTTTAAGAGTCCAGTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145486.2-758s1c1
Sequence:CCGGTGGTCTCTTTCCGATACCATTCTCGAGAATGGTATCGGAAAGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145486.2-757s1c1
Sequence:CCGGCTGGTCTCTTTCCGATACCATCTCGAGATGGTATCGGAAAGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145486.2-273s1c1
Sequence:CCGGGCCACCTCAATATGTAGCACACTCGAGTGTGCTACATATTGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145486
VALIDATED
MARCH2 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145486.2-2577s1c1
Sequence:CCGGGCCAAGTTTGACACCCTAAATCTCGAGATTTAGGGTGTCAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145486.2-870s1c1
Sequence:CCGGGCTGGCTACTGGACTCTTAAACTCGAGTTTAAGAGTCCAGTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145486.2-758s1c1
Sequence:CCGGTGGTCTCTTTCCGATACCATTCTCGAGAATGGTATCGGAAAGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145486.2-757s1c1
Sequence:CCGGCTGGTCTCTTTCCGATACCATCTCGAGATGGTATCGGAAAGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145486.2-273s1c1
Sequence:CCGGGCCACCTCAATATGTAGCACACTCGAGTGTGCTACATATTGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145486
VALIDATED
MARCH2 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145486.2-2577s1c1
Sequence:CCGGGCCAAGTTTGACACCCTAAATCTCGAGATTTAGGGTGTCAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145486.2-870s1c1
Sequence:CCGGGCTGGCTACTGGACTCTTAAACTCGAGTTTAAGAGTCCAGTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145486.2-758s1c1
Sequence:CCGGTGGTCTCTTTCCGATACCATTCTCGAGAATGGTATCGGAAAGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145486.2-757s1c1
Sequence:CCGGCTGGTCTCTTTCCGATACCATCTCGAGATGGTATCGGAAAGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145486.2-273s1c1
Sequence:CCGGGCCACCTCAATATGTAGCACACTCGAGTGTGCTACATATTGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks