EMAIL THIS PAGE TO A FRIEND

MARVELD3

MARVEL domain containing 3

Synonyms: MARVD3 MRVLDC3
UniProtKB ID: Q96A59, A8K820, H3BQM5, Q96MJ4
Gene ID:
Mouse(73608) MARVEL (membrane-associating) domain containing 3
Rat(498950) MARVEL domain containing 3
Zebrafish(393501) MARVEL domain containing 3
chicken(420903) MARVEL domain containing 3
dog(489723) MARVEL domain containing 3
chicken(415883) MARVEL domain containing 3
dog(610700) MARVEL domain containing 3
domestic cat(101085167) MARVEL domain containing 3
cow(533131) MARVEL domain containing 3
sheep(101114971) MARVEL domain containing 3
domestic guinea pig(100728251) MARVEL domain containing 3
naked mole-rat(101700252) MARVEL domain containing 3
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052858 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_212447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017967 Rosetta Predictions human pricing
NM_052858 Rosetta Predictions human pricing
NM_001109132 Rosetta Predictions rat pricing
NM_028584 Rosetta Predictions mouse pricing
NM_212447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116049 predicted 1405
2 SASI_Hs01_00116050 predicted 1254
3 SASI_Hs01_00116051 predicted 1214
4 SASI_Hs01_00116052 predicted 925
5 SASI_Hs01_00116053 predicted 580
6 SASI_Hs01_00116054 predicted 1358
7 SASI_Hs01_00116055 predicted 891
8 SASI_Hs02_00306838 predicted 1152
9 SASI_Hs02_00306839 predicted 1396
10 SASI_Hs01_00116057 predicted 704
11 SASI_Hs01_00116056 predicted 1149
12 SASI_Hs01_00116058 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024417 predicted 1466
2 SASI_Hs01_00024418 predicted 1240
3 SASI_Hs01_00024419 predicted 1132
4 SASI_Hs01_00024420 predicted 866
5 SASI_Hs01_00024421 predicted 575
6 SASI_Hs01_00024422 predicted 1201
7 SASI_Hs01_00024423 predicted 863
8 SASI_Hs01_00024424 predicted 1040
9 SASI_Hs01_00024425 predicted 955
10 SASI_Hs02_00361552 predicted 570
11 SASI_Hs01_00024416 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245440 predicted 222
2 SASI_Rn02_00245441 predicted 609
3 SASI_Rn02_00245442 predicted 740
4 SASI_Rn02_00245443 predicted 878
5 SASI_Rn02_00245444 predicted 483
6 SASI_Rn02_00245445 predicted 582
7 SASI_Rn02_00245446 predicted 312
8 SASI_Rn02_00245447 predicted 659
9 SASI_Rn02_00245448 predicted 855
10 SASI_Rn02_00245449 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145405 predicted 225
2 SASI_Mm01_00145406 predicted 291
3 SASI_Mm01_00145407 predicted 290
4 SASI_Mm01_00145408 predicted 308
5 SASI_Mm01_00145409 predicted 253
6 SASI_Mm01_00145410 predicted 286
7 SASI_Mm01_00145411 predicted 308
8 SASI_Mm01_00145412 predicted 221
9 SASI_Mm01_00145413 predicted 249
10 SASI_Mm01_00145414 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176720 predicted 216
2 SASI_Mm01_00176721 predicted 284
3 SASI_Mm01_00176722 predicted 281
4 SASI_Mm01_00176723 predicted 307
5 SASI_Mm01_00176724 predicted 244
6 SASI_Mm01_00176725 predicted 285
7 SASI_Mm01_00176726 predicted 301
8 SASI_Mm01_00176727 predicted 215
9 SASI_Mm01_00176728 predicted 248
10 SASI_Mm01_00176729 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052858
MARVELD3 MISSION shRNA Bacterial Glycerol Stock
MARVEL domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-1122s1c1
Sequence:CCGGGATATAGGAGCTGGAATCTTTCTCGAGAAAGATTCCAGCTCCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-824s1c1
Sequence:CCGGCCAGTTCTACCAGCTAAAGCTCTCGAGAGCTTTAGCTGGTAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-691s1c1
Sequence:CCGGGCTCTGTGTCTTACAGTTCCACTCGAGTGGAACTGTAAGACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-1117s1c1
Sequence:CCGGGAGCAGATATAGGAGCTGGAACTCGAGTTCCAGCTCCTATATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052858.3-1466s21c1
Sequence:CCGGGTGAGTGAGGGACCAATCAAACTCGAGTTTGATTGGTCCCTCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052858.3-621s21c1
Sequence:CCGGGGAATGCCACAAATGCAAATACTCGAGTATTTGCATTTGTGGCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052858.3-576s21c1
Sequence:CCGGACGAGAGGAGGTGGAATATTACTCGAGTAATATTCCACCTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052858.3-1099s21c1
Sequence:CCGGAGCAAAGGCTACAGCGGTTTCCTCGAGGAAACCGCTGTAGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052858
MARVELD3 MISSION shRNA shRNA Plasmid DNA
MARVEL domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-1122s1c1
Sequence:CCGGGATATAGGAGCTGGAATCTTTCTCGAGAAAGATTCCAGCTCCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-824s1c1
Sequence:CCGGCCAGTTCTACCAGCTAAAGCTCTCGAGAGCTTTAGCTGGTAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-691s1c1
Sequence:CCGGGCTCTGTGTCTTACAGTTCCACTCGAGTGGAACTGTAAGACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-1117s1c1
Sequence:CCGGGAGCAGATATAGGAGCTGGAACTCGAGTTCCAGCTCCTATATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052858.3-1466s21c1
Sequence:CCGGGTGAGTGAGGGACCAATCAAACTCGAGTTTGATTGGTCCCTCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052858.3-621s21c1
Sequence:CCGGGGAATGCCACAAATGCAAATACTCGAGTATTTGCATTTGTGGCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052858.3-576s21c1
Sequence:CCGGACGAGAGGAGGTGGAATATTACTCGAGTAATATTCCACCTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052858.3-1099s21c1
Sequence:CCGGAGCAAAGGCTACAGCGGTTTCCTCGAGGAAACCGCTGTAGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052858
MARVELD3 MISSION shRNA Lentiviral Transduction Particles
MARVEL domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-1122s1c1
Sequence:CCGGGATATAGGAGCTGGAATCTTTCTCGAGAAAGATTCCAGCTCCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-824s1c1
Sequence:CCGGCCAGTTCTACCAGCTAAAGCTCTCGAGAGCTTTAGCTGGTAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-691s1c1
Sequence:CCGGGCTCTGTGTCTTACAGTTCCACTCGAGTGGAACTGTAAGACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052858.2-1117s1c1
Sequence:CCGGGAGCAGATATAGGAGCTGGAACTCGAGTTCCAGCTCCTATATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052858.3-1466s21c1
Sequence:CCGGGTGAGTGAGGGACCAATCAAACTCGAGTTTGATTGGTCCCTCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052858.3-621s21c1
Sequence:CCGGGGAATGCCACAAATGCAAATACTCGAGTATTTGCATTTGTGGCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052858.3-576s21c1
Sequence:CCGGACGAGAGGAGGTGGAATATTACTCGAGTAATATTCCACCTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052858.3-1099s21c1
Sequence:CCGGAGCAAAGGCTACAGCGGTTTCCTCGAGGAAACCGCTGTAGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212447
MARVELD3 MISSION shRNA Bacterial Glycerol Stock
MARVEL domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-1132s1c1
Sequence:CCGGCCGAGAACAGAAGCACTACAACTCGAGTTGTAGTGCTTCTGTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-688s1c1
Sequence:CCGGCGGCTTCGGAAATAACTATTACTCGAGTAATAGTTATTTCCGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-311s1c1
Sequence:CCGGGCCTTGGAGAAGTCCCGTCAACTCGAGTTGACGGGACTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-1158s1c1
Sequence:CCGGGCCAGGAACAACACAGAAATTCTCGAGAATTTCTGTGTTGTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-509s1c1
Sequence:CCGGGAGGAATATTACCAGTCGGAACTCGAGTTCCGACTGGTAATATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212447
MARVELD3 MISSION shRNA shRNA Plasmid DNA
MARVEL domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-1132s1c1
Sequence:CCGGCCGAGAACAGAAGCACTACAACTCGAGTTGTAGTGCTTCTGTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-688s1c1
Sequence:CCGGCGGCTTCGGAAATAACTATTACTCGAGTAATAGTTATTTCCGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-311s1c1
Sequence:CCGGGCCTTGGAGAAGTCCCGTCAACTCGAGTTGACGGGACTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-1158s1c1
Sequence:CCGGGCCAGGAACAACACAGAAATTCTCGAGAATTTCTGTGTTGTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-509s1c1
Sequence:CCGGGAGGAATATTACCAGTCGGAACTCGAGTTCCGACTGGTAATATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212447
MARVELD3 MISSION shRNA Lentiviral Transduction Particles
MARVEL domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-1132s1c1
Sequence:CCGGCCGAGAACAGAAGCACTACAACTCGAGTTGTAGTGCTTCTGTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-688s1c1
Sequence:CCGGCGGCTTCGGAAATAACTATTACTCGAGTAATAGTTATTTCCGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-311s1c1
Sequence:CCGGGCCTTGGAGAAGTCCCGTCAACTCGAGTTGACGGGACTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-1158s1c1
Sequence:CCGGGCCAGGAACAACACAGAAATTCTCGAGAATTTCTGTGTTGTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212447.1-509s1c1
Sequence:CCGGGAGGAATATTACCAGTCGGAACTCGAGTTCCGACTGGTAATATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks