EMAIL THIS PAGE TO A FRIEND

MAST2

microtubule associated serine/threonine kinase 2

Synonyms: MAST205 MTSSK
Gene ID:
Mouse(17776) microtubule associated serine/threonine kinase 2
Rat(313819) microtubule associated serine/threonine kinase 2
Zebrafish(100001267) microtubule associated serine/threonine kinase 2
chicken(424606) microtubule associated serine/threonine kinase 2
cow(535643) microtubule associated serine/threonine kinase 2
domestic cat(101081744) microtubule associated serine/threonine kinase 2
dog(482513) microtubule associated serine/threonine kinase 2
naked mole-rat(101715246) microtubule associated serine/threonine kinase 2
domestic guinea pig(100721943) microtubule associated serine/threonine kinase 2
sheep(101111852) microtubule associated serine/threonine kinase 2
Gene Class: Cytoskeleton
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015112 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015112 Rosetta Predictions human pricing
NM_001108005 Rosetta Predictions rat pricing
NM_001042743 Rosetta Predictions mouse pricing
NM_008641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099049 predicted 2416
2 SASI_Hs02_00347000 predicted 786
3 SASI_Hs02_00347001 predicted 1424
4 SASI_Hs01_00099050 predicted 699
5 SASI_Hs01_00099052 predicted 752
6 SASI_Hs01_00099053 predicted 2473
7 SASI_Hs01_00099055 predicted 2259
8 SASI_Hs01_00099054 predicted 801
9 SASI_Hs02_00347002 predicted 2310
10 SASI_Hs01_00099056 predicted 1347
11 SASI_Hs01_00099047 predicted 1294
12 SASI_Hs01_00099048 predicted 1576
13 SASI_Hs01_00099051 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234425 predicted 3823
2 SASI_Rn02_00234426 predicted 1976
3 SASI_Rn02_00234427 predicted 2274
4 SASI_Rn02_00234428 predicted 826
5 SASI_Rn02_00234429 predicted 1589
6 SASI_Rn02_00234430 predicted 2109
7 SASI_Rn02_00234431 predicted 359
8 SASI_Rn02_00234432 predicted 2678
9 SASI_Rn02_00234433 predicted 751
10 SASI_Rn02_00234434 predicted 1710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291085 predicted 479
2 SASI_Mm02_00291086 predicted 3009
3 SASI_Mm02_00291087 predicted 2587
4 SASI_Mm02_00291088 predicted 1304
5 SASI_Mm02_00291089 predicted 1973
6 SASI_Mm02_00291090 predicted 4870
7 SASI_Mm02_00291091 predicted 1319
8 SASI_Mm02_00291092 predicted 4542
9 SASI_Mm02_00291093 predicted 5285
10 SASI_Mm02_00291094 predicted 2997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314364 predicted 483
2 SASI_Mm01_00179605 predicted 2983
3 SASI_Mm01_00179606 predicted 2572
4 SASI_Mm01_00179607 predicted 1283
5 SASI_Mm01_00179608 predicted 1955
6 SASI_Mm01_00179609 predicted 4852
7 SASI_Mm01_00179610 predicted 1298
8 SASI_Mm01_00179611 predicted 4516
9 SASI_Mm01_00179612 predicted 5266
10 SASI_Mm01_00179613 predicted 2968
11 SASI_Mm01_00179614 predicted 3677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015112
VALIDATED
MAST2 MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015112.1-1811s1c1
Sequence:CCGGGAGGACTTCGAGACCATTAAGCTCGAGCTTAATGGTCTCGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015112.x-698s1c1
Sequence:CCGGCGAATGAGAAACCAGTCCCTTCTCGAGAAGGGACTGGTTTCTCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015112.x-1268s1c1
Sequence:CCGGGCACAAATGGAAGAGCGACTACTCGAGTAGTCGCTCTTCCATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-2701s21c1
Sequence:GTACCGGAGAGGATGATACTAGCTATTTCTCGAGAAATAGCTAGTATCATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-1268s21c1
Sequence:CCGGGCACAAATGGAAGAGCGACTACTCGAGTAGTCGCTCTTCCATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015112.2-2107s1c1
Sequence:CCGGTGTGGACATGGTGCGTCTATACTCGAGTATAGACGCACCATGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015112.2-2283s1c1
Sequence:CCGGACTTGTATGAGGGTCATATTGCTCGAGCAATATGACCCTCATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-2283s21c1
Sequence:CCGGACTTGTATGAGGGTCATATTGCTCGAGCAATATGACCCTCATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-5154s21c1
Sequence:CCGGCCCAGGCACTAACAGCACTTTCTCGAGAAAGTGCTGTTAGTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-3138s21c1
Sequence:CCGGGGCAACCACAGGAGGGTATATCTCGAGATATACCCTCCTGTGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015112
VALIDATED
MAST2 MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015112.1-1811s1c1
Sequence:CCGGGAGGACTTCGAGACCATTAAGCTCGAGCTTAATGGTCTCGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015112.x-698s1c1
Sequence:CCGGCGAATGAGAAACCAGTCCCTTCTCGAGAAGGGACTGGTTTCTCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015112.x-1268s1c1
Sequence:CCGGGCACAAATGGAAGAGCGACTACTCGAGTAGTCGCTCTTCCATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-2701s21c1
Sequence:GTACCGGAGAGGATGATACTAGCTATTTCTCGAGAAATAGCTAGTATCATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-1268s21c1
Sequence:CCGGGCACAAATGGAAGAGCGACTACTCGAGTAGTCGCTCTTCCATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015112.2-2107s1c1
Sequence:CCGGTGTGGACATGGTGCGTCTATACTCGAGTATAGACGCACCATGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015112.2-2283s1c1
Sequence:CCGGACTTGTATGAGGGTCATATTGCTCGAGCAATATGACCCTCATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-2283s21c1
Sequence:CCGGACTTGTATGAGGGTCATATTGCTCGAGCAATATGACCCTCATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-5154s21c1
Sequence:CCGGCCCAGGCACTAACAGCACTTTCTCGAGAAAGTGCTGTTAGTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-3138s21c1
Sequence:CCGGGGCAACCACAGGAGGGTATATCTCGAGATATACCCTCCTGTGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015112
VALIDATED
MAST2 MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015112.1-1811s1c1
Sequence:CCGGGAGGACTTCGAGACCATTAAGCTCGAGCTTAATGGTCTCGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015112.x-698s1c1
Sequence:CCGGCGAATGAGAAACCAGTCCCTTCTCGAGAAGGGACTGGTTTCTCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015112.x-1268s1c1
Sequence:CCGGGCACAAATGGAAGAGCGACTACTCGAGTAGTCGCTCTTCCATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-2701s21c1
Sequence:GTACCGGAGAGGATGATACTAGCTATTTCTCGAGAAATAGCTAGTATCATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-1268s21c1
Sequence:CCGGGCACAAATGGAAGAGCGACTACTCGAGTAGTCGCTCTTCCATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015112.2-2107s1c1
Sequence:CCGGTGTGGACATGGTGCGTCTATACTCGAGTATAGACGCACCATGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015112.2-2283s1c1
Sequence:CCGGACTTGTATGAGGGTCATATTGCTCGAGCAATATGACCCTCATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-2283s21c1
Sequence:CCGGACTTGTATGAGGGTCATATTGCTCGAGCAATATGACCCTCATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-5154s21c1
Sequence:CCGGCCCAGGCACTAACAGCACTTTCTCGAGAAAGTGCTGTTAGTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015112.2-3138s21c1
Sequence:CCGGGGCAACCACAGGAGGGTATATCTCGAGATATACCCTCCTGTGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008641
VALIDATED
MAST2 MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008641.1-3056s1c1
Sequence:CCGGCCCTGTCAACAAAGTAATCAACTCGAGTTGATTACTTTGTTGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008641.1-4926s1c1
Sequence:CCGGGCATCCACGAACAAGACCATACTCGAGTATGGTCTTGTTCGTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008641.1-351s1c1
Sequence:CCGGCGAATGAGAAACCAATCCCTTCTCGAGAAGGGATTGGTTTCTCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008641.1-3455s1c1
Sequence:CCGGGCTGGTTCTGAAGAGTGGAAACTCGAGTTTCCACTCTTCAGAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008641.1-1067s1c1
Sequence:CCGGCCTCATTACGTCACACTATTTCTCGAGAAATAGTGTGACGTAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-3801s21c1
Sequence:GTACCGGGTGGAAACAAGGTATCAATTTCTCGAGAAATTGATACCTTGTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-3117s21c1
Sequence:CCGGAGCAACAACAGGAAGGTATATCTCGAGATATACCTTCCTGTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-2271s21c1
Sequence:CCGGACTTGTATGAGGGTCATATTGCTCGAGCAATATGACCCTCATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-2007s21c1
Sequence:CCGGTTGAGACCAAGCGTCACTTATCTCGAGATAAGTGACGCTTGGTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-1399s21c1
Sequence:CCGGCCTCATTACGTCACACTATTTCTCGAGAAATAGTGTGACGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008641
VALIDATED
MAST2 MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008641.1-3056s1c1
Sequence:CCGGCCCTGTCAACAAAGTAATCAACTCGAGTTGATTACTTTGTTGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008641.1-4926s1c1
Sequence:CCGGGCATCCACGAACAAGACCATACTCGAGTATGGTCTTGTTCGTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008641.1-351s1c1
Sequence:CCGGCGAATGAGAAACCAATCCCTTCTCGAGAAGGGATTGGTTTCTCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008641.1-3455s1c1
Sequence:CCGGGCTGGTTCTGAAGAGTGGAAACTCGAGTTTCCACTCTTCAGAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008641.1-1067s1c1
Sequence:CCGGCCTCATTACGTCACACTATTTCTCGAGAAATAGTGTGACGTAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-3801s21c1
Sequence:GTACCGGGTGGAAACAAGGTATCAATTTCTCGAGAAATTGATACCTTGTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-3117s21c1
Sequence:CCGGAGCAACAACAGGAAGGTATATCTCGAGATATACCTTCCTGTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-2271s21c1
Sequence:CCGGACTTGTATGAGGGTCATATTGCTCGAGCAATATGACCCTCATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-2007s21c1
Sequence:CCGGTTGAGACCAAGCGTCACTTATCTCGAGATAAGTGACGCTTGGTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-1399s21c1
Sequence:CCGGCCTCATTACGTCACACTATTTCTCGAGAAATAGTGTGACGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008641
VALIDATED
MAST2 MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008641.1-3056s1c1
Sequence:CCGGCCCTGTCAACAAAGTAATCAACTCGAGTTGATTACTTTGTTGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008641.1-4926s1c1
Sequence:CCGGGCATCCACGAACAAGACCATACTCGAGTATGGTCTTGTTCGTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008641.1-351s1c1
Sequence:CCGGCGAATGAGAAACCAATCCCTTCTCGAGAAGGGATTGGTTTCTCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008641.1-3455s1c1
Sequence:CCGGGCTGGTTCTGAAGAGTGGAAACTCGAGTTTCCACTCTTCAGAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008641.1-1067s1c1
Sequence:CCGGCCTCATTACGTCACACTATTTCTCGAGAAATAGTGTGACGTAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-3801s21c1
Sequence:GTACCGGGTGGAAACAAGGTATCAATTTCTCGAGAAATTGATACCTTGTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-3117s21c1
Sequence:CCGGAGCAACAACAGGAAGGTATATCTCGAGATATACCTTCCTGTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-2271s21c1
Sequence:CCGGACTTGTATGAGGGTCATATTGCTCGAGCAATATGACCCTCATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-2007s21c1
Sequence:CCGGTTGAGACCAAGCGTCACTTATCTCGAGATAAGTGACGCTTGGTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008641.2-1399s21c1
Sequence:CCGGCCTCATTACGTCACACTATTTCTCGAGAAATAGTGTGACGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks