EMAIL THIS PAGE TO A FRIEND

MAST3

microtubule associated serine/threonine kinase 3

UniProtKB ID: O60307, Q7LDZ8, Q9UPI0
Gene ID:
Mouse(546071) microtubule associated serine/threonine kinase 3
Rat(688540) microtubule associated serine/threonine kinase 3
sheep(101111802) microtubule associated serine/threonine kinase 3
domestic guinea pig(100715574) microtubule associated serine/threonine kinase 3
naked mole-rat(101702669) microtubule associated serine/threonine kinase 3
chicken(420130) microtubule associated serine/threonine kinase 3
domestic cat(101093339) microtubule associated serine/threonine kinase 3
cow(534230) microtubule associated serine/threonine kinase 3
dog(476670) microtubule associated serine/threonine kinase 3
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015016 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_038150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_038150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_038150 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015016 Rosetta Predictions human pricing
XM_038150 Rosetta Predictions human pricing
NM_001134796 Rosetta Predictions rat pricing
XM_001064796 Rosetta Predictions rat pricing
XM_001064855 Rosetta Predictions rat pricing
XM_888290 Rosetta Predictions mouse pricing
XM_897954 Rosetta Predictions mouse pricing
XM_979773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346789 predicted 853
2 SASI_Hs02_00346790 predicted 1101
3 SASI_Hs02_00346791 predicted 1310
4 SASI_Hs02_00346792 predicted 1996
5 SASI_Hs02_00346793 predicted 1229
6 SASI_Hs02_00346794 predicted 2164
7 SASI_Hs02_00346795 predicted 1782
8 SASI_Hs02_00346796 predicted 941
9 SASI_Hs02_00346797 predicted 779
10 SASI_Hs02_00346798 predicted 3952
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_038150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292114 predicted 862
2 SASI_Hs01_00292115 predicted 1101
3 SASI_Hs01_00292116 predicted 1322
4 SASI_Hs01_00292117 predicted 405
5 SASI_Hs01_00292118 predicted 1998
6 SASI_Hs01_00292119 predicted 1236
7 SASI_Hs01_00292120 predicted 1791
8 SASI_Hs01_00292121 predicted 947
9 SASI_Hs01_00292122 predicted 783
10 SASI_Hs01_00292123 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258544 predicted 1237
2 SASI_Rn02_00258545 predicted 640
3 SASI_Rn02_00258546 predicted 3651
4 SASI_Rn02_00258547 predicted 830
5 SASI_Rn02_00258548 predicted 2091
6 SASI_Rn02_00258549 predicted 1331
7 SASI_Rn02_00258550 predicted 621
8 SASI_Rn02_00258551 predicted 2540
9 SASI_Rn02_00258552 predicted 2601
10 SASI_Rn02_00258553 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311787 predicted 1207
2 SASI_Rn02_00311788 predicted 816
3 SASI_Rn02_00311789 predicted 616
4 SASI_Rn02_00311790 predicted 803
5 SASI_Rn02_00311791 predicted 2065
6 SASI_Rn02_00311792 predicted 1303
7 SASI_Rn02_00311793 predicted 591
8 SASI_Rn02_00311794 predicted 2517
9 SASI_Rn02_00311795 predicted 2577
10 SASI_Rn02_00311796 predicted 1896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311988 predicted 1209
2 SASI_Rn02_00311989 predicted 618
3 SASI_Rn02_00311990 predicted 3628
4 SASI_Rn02_00311991 predicted 803
5 SASI_Rn02_00311992 predicted 2069
6 SASI_Rn02_00311993 predicted 1296
7 SASI_Rn02_00311994 predicted 589
8 SASI_Rn02_00311995 predicted 2516
9 SASI_Rn02_00311996 predicted 2579
10 SASI_Rn02_00311997 predicted 1892
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211410 predicted 3998
2 SASI_Mm01_00211411 predicted 1264
3 SASI_Mm02_00428621 predicted 1657
4 SASI_Mm01_00211412 predicted 3276
5 SASI_Mm01_00211413 predicted 2404
6 SASI_Mm01_00211414 predicted 1575
7 SASI_Mm01_00211415 predicted 551
8 SASI_Mm01_00211416 predicted 2032
9 SASI_Mm01_00211417 predicted 1855
10 SASI_Mm02_00428622 predicted 1067
11 SASI_Mm01_00211418 predicted 2239
12 SASI_Mm01_00211419 predicted 4038
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247005 predicted 788
2 SASI_Mm01_00247006 predicted 1675
3 SASI_Mm01_00247007 predicted 1266
4 SASI_Mm01_00247008 predicted 1656
5 SASI_Mm01_00247009 predicted 2368
6 SASI_Mm01_00247010 predicted 1576
7 SASI_Mm01_00247011 predicted 560
8 SASI_Mm01_00247012 predicted 2374
9 SASI_Mm01_00247013 predicted 2039
10 SASI_Mm01_00247014 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447063 predicted 3995
2 SASI_Mm02_00447064 predicted 1265
3 SASI_Mm02_00447065 predicted 1652
4 SASI_Mm02_00447066 predicted 4033
5 SASI_Mm02_00447067 predicted 3269
6 SASI_Mm02_00447068 predicted 2408
7 SASI_Mm02_00447069 predicted 1568
8 SASI_Mm02_00447070 predicted 557
9 SASI_Mm02_00447071 predicted 2027
10 SASI_Mm02_00447072 predicted 1858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015016
MAST3 MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000230628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015016.1-2154s21c1
Sequence:CCGGCACTCCTACCTTCGCTGAAAGCTCGAGCTTTCAGCGAAGGTAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015016.1-175s21c1
Sequence:CCGGTTGGATAGTCCTCGGAATTTCCTCGAGGAAATTCCGAGGACTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015016.1-4154s21c1
Sequence:GTACCGGGCAAATCCCTGCAACTAATTTCTCGAGAAATTAGTTGCAGGGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015016.1-1082s21c1
Sequence:CCGGAGCCATGCGAAAGCGACTTTGCTCGAGCAAAGTCGCTTTCGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015016
MAST3 MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000230628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015016.1-2154s21c1
Sequence:CCGGCACTCCTACCTTCGCTGAAAGCTCGAGCTTTCAGCGAAGGTAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015016.1-175s21c1
Sequence:CCGGTTGGATAGTCCTCGGAATTTCCTCGAGGAAATTCCGAGGACTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015016.1-4154s21c1
Sequence:GTACCGGGCAAATCCCTGCAACTAATTTCTCGAGAAATTAGTTGCAGGGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015016.1-1082s21c1
Sequence:CCGGAGCCATGCGAAAGCGACTTTGCTCGAGCAAAGTCGCTTTCGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015016
MAST3 MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000230628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015016.1-2154s21c1
Sequence:CCGGCACTCCTACCTTCGCTGAAAGCTCGAGCTTTCAGCGAAGGTAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015016.1-175s21c1
Sequence:CCGGTTGGATAGTCCTCGGAATTTCCTCGAGGAAATTCCGAGGACTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015016.1-4154s21c1
Sequence:GTACCGGGCAAATCCCTGCAACTAATTTCTCGAGAAATTAGTTGCAGGGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015016.1-1082s21c1
Sequence:CCGGAGCCATGCGAAAGCGACTTTGCTCGAGCAAAGTCGCTTTCGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_038150
VALIDATED
MAST3 MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_038150.3-4483s1c1
Sequence:CCGGCCCAGCCTAATTTATTACTTTCTCGAGAAAGTAATAAATTAGGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.3-1243s1c1
Sequence:CCGGGAGCGTGACATTCTCACCTTTCTCGAGAAAGGTGAGAATGTCACGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.3-2357s1c1
Sequence:CCGGTGCCCAAGTTTGCCTTCTCATCTCGAGATGAGAAGGCAAACTTGGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.3-1431s1c1
Sequence:CCGGGCTGGAGTACCTGCATAACTACTCGAGTAGTTATGCAGGTACTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_038150.6-2486s1c1
Sequence:CCGGCGAGCCTTTCTGCCGACACAGCTCGAGCTGTGTCGGCAGAAAGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_038150.6-4140s1c1
Sequence:CCGGCTTTGTAAATAGCAGCAAATCCTCGAGGATTTGCTGCTATTTACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.6-1318s1c1
Sequence:CCGGCTATGTATGGTCATGGAATACCTCGAGGTATTCCATGACCATACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_038150.6-5014s1c1
Sequence:CCGGCACTGATAAAGGAAGGTACAGCTCGAGCTGTACCTTCCTTTATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_038150.6-1094s1c1
Sequence:CCGGGCGACTTTGAGACCATCAAACCTCGAGGTTTGATGGTCTCAAAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.6-3774s1c1
Sequence:CCGGGCGCCGAGACTCCTTCAAGAACTCGAGTTCTTGAAGGAGTCTCGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_038150
VALIDATED
MAST3 MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_038150.3-4483s1c1
Sequence:CCGGCCCAGCCTAATTTATTACTTTCTCGAGAAAGTAATAAATTAGGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.3-1243s1c1
Sequence:CCGGGAGCGTGACATTCTCACCTTTCTCGAGAAAGGTGAGAATGTCACGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.3-2357s1c1
Sequence:CCGGTGCCCAAGTTTGCCTTCTCATCTCGAGATGAGAAGGCAAACTTGGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.3-1431s1c1
Sequence:CCGGGCTGGAGTACCTGCATAACTACTCGAGTAGTTATGCAGGTACTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_038150.6-2486s1c1
Sequence:CCGGCGAGCCTTTCTGCCGACACAGCTCGAGCTGTGTCGGCAGAAAGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_038150.6-4140s1c1
Sequence:CCGGCTTTGTAAATAGCAGCAAATCCTCGAGGATTTGCTGCTATTTACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.6-1318s1c1
Sequence:CCGGCTATGTATGGTCATGGAATACCTCGAGGTATTCCATGACCATACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_038150.6-5014s1c1
Sequence:CCGGCACTGATAAAGGAAGGTACAGCTCGAGCTGTACCTTCCTTTATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_038150.6-1094s1c1
Sequence:CCGGGCGACTTTGAGACCATCAAACCTCGAGGTTTGATGGTCTCAAAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.6-3774s1c1
Sequence:CCGGGCGCCGAGACTCCTTCAAGAACTCGAGTTCTTGAAGGAGTCTCGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_038150
VALIDATED
MAST3 MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_038150.3-4483s1c1
Sequence:CCGGCCCAGCCTAATTTATTACTTTCTCGAGAAAGTAATAAATTAGGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.3-1243s1c1
Sequence:CCGGGAGCGTGACATTCTCACCTTTCTCGAGAAAGGTGAGAATGTCACGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.3-2357s1c1
Sequence:CCGGTGCCCAAGTTTGCCTTCTCATCTCGAGATGAGAAGGCAAACTTGGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.3-1431s1c1
Sequence:CCGGGCTGGAGTACCTGCATAACTACTCGAGTAGTTATGCAGGTACTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_038150.6-2486s1c1
Sequence:CCGGCGAGCCTTTCTGCCGACACAGCTCGAGCTGTGTCGGCAGAAAGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_038150.6-4140s1c1
Sequence:CCGGCTTTGTAAATAGCAGCAAATCCTCGAGGATTTGCTGCTATTTACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.6-1318s1c1
Sequence:CCGGCTATGTATGGTCATGGAATACCTCGAGGTATTCCATGACCATACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_038150.6-5014s1c1
Sequence:CCGGCACTGATAAAGGAAGGTACAGCTCGAGCTGTACCTTCCTTTATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_038150.6-1094s1c1
Sequence:CCGGGCGACTTTGAGACCATCAAACCTCGAGGTTTGATGGTCTCAAAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038150.6-3774s1c1
Sequence:CCGGGCGCCGAGACTCCTTCAAGAACTCGAGTTCTTGAAGGAGTCTCGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks