EMAIL THIS PAGE TO A FRIEND

MAT2A

methionine adenosyltransferase II, alpha

Synonyms: MATA2 MATII SAMS2
UniProtKB ID: P31153, A8K511, D6W5L1, Q53SP5
Gene ID:
Human(4144) Summary: The protein encoded by this gene catalyzes the production of S-adenosylmethionine (AdoMet) from methionine and ATP. AdoMet is the key methyl donor in cellular processes. [provided by RefSeq, Jun 2011]
Mouse(232087) methionine adenosyltransferase II, alpha
Rat(171347) methionine adenosyltransferase II, alpha
domestic guinea pig(100729260) methionine adenosyltransferase II, alpha
naked mole-rat(101703803) methionine adenosyltransferase II, alpha
Domestic Rabbit(100339456) methionine adenosyltransferase II, alpha
sheep(101102380) methionine adenosyltransferase II, alpha
cow(527403) methionine adenosyltransferase II, alpha
domestic cat(101085366) methionine adenosyltransferase II, alpha
dog(475770) methionine adenosyltransferase II, alpha
190 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005911 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005911 Rosetta Predictions human pricing
NM_134351 Rosetta Predictions rat pricing
NM_145569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041617 predicted 207
2 SASI_Hs01_00041620 predicted 592
3 SASI_Hs01_00041621 predicted 269
4 SASI_Hs01_00041623 predicted 577
5 SASI_Hs01_00041624 predicted 616
6 SASI_Hs01_00041625 predicted 624
7 SASI_Hs01_00041626 predicted 666
8 SASI_Hs02_00340527 predicted 800
9 SASI_Hs02_00340528 predicted 1073
10 SASI_Hs02_00340529 predicted 660
11 SASI_Hs01_00041618 predicted 788
12 SASI_Hs01_00041619 predicted 1092
13 SASI_Hs01_00041622 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043534 predicted 419
2 SASI_Rn01_00043535 predicted 733
3 SASI_Rn01_00043536 predicted 222
4 SASI_Rn01_00043537 predicted 776
5 SASI_Rn01_00043538 predicted 351
6 SASI_Rn01_00043539 predicted 702
7 SASI_Rn01_00043540 predicted 663
8 SASI_Rn02_00267907 predicted 511
9 SASI_Rn01_00043541 predicted 850
10 SASI_Rn01_00043542 predicted 1104
11 SASI_Rn01_00043543 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100144 predicted 1145
2 SASI_Mm01_00100145 predicted 822
3 SASI_Mm02_00341080 predicted 783
4 SASI_Mm01_00100146 predicted 270
5 SASI_Mm01_00100147 predicted 370
6 SASI_Mm01_00100148 predicted 584
7 SASI_Mm01_00100149 predicted 445
8 SASI_Mm01_00100150 predicted 610
9 SASI_Mm01_00100151 predicted 666
10 SASI_Mm01_00100153 predicted 747
11 SASI_Mm01_00100152 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145569
VALIDATED
MAT2A MISSION shRNA Bacterial Glycerol Stock
methionine adenosyltransferase II, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-2014s21c1
Sequence:CCGGTTTGGAGGACGTACGTAATAACTCGAGTTATTACGTACGTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-825s21c1
Sequence:CCGGTACCTTGATGAGGATACAATTCTCGAGAATTGTATCCTCATCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-1215s21c1
Sequence:CCGGGATCTGAAGAAGCCAATTTATCTCGAGATAAATTGGCTTCTTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-493s21c1
Sequence:CCGGACCGGAATGAGGAAGATATTGCTCGAGCAATATCTTCCTCATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145569.2-1797s1c1
Sequence:CCGGCCTCCCTGTAACTCATTTCTACTCGAGTAGAAATGAGTTACAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-592s1c1
Sequence:CCGGGCACACAAGCTAAATGCCAAACTCGAGTTTGGCATTTAGCTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-1034s1c1
Sequence:CCGGCCCTTGTTAAAGGAGGTCTGTCTCGAGACAGACCTCCTTTAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-724s1c1
Sequence:CCGGCACACGATTGTTATATCTGTTCTCGAGAACAGATATAACAATCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-379s1c1
Sequence:CCGGGCCATAAAGCACATTGGATATCTCGAGATATCCAATGTGCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145569
VALIDATED
MAT2A MISSION shRNA shRNA Plasmid DNA
methionine adenosyltransferase II, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-2014s21c1
Sequence:CCGGTTTGGAGGACGTACGTAATAACTCGAGTTATTACGTACGTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-825s21c1
Sequence:CCGGTACCTTGATGAGGATACAATTCTCGAGAATTGTATCCTCATCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-1215s21c1
Sequence:CCGGGATCTGAAGAAGCCAATTTATCTCGAGATAAATTGGCTTCTTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-493s21c1
Sequence:CCGGACCGGAATGAGGAAGATATTGCTCGAGCAATATCTTCCTCATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145569.2-1797s1c1
Sequence:CCGGCCTCCCTGTAACTCATTTCTACTCGAGTAGAAATGAGTTACAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-592s1c1
Sequence:CCGGGCACACAAGCTAAATGCCAAACTCGAGTTTGGCATTTAGCTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-1034s1c1
Sequence:CCGGCCCTTGTTAAAGGAGGTCTGTCTCGAGACAGACCTCCTTTAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-724s1c1
Sequence:CCGGCACACGATTGTTATATCTGTTCTCGAGAACAGATATAACAATCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-379s1c1
Sequence:CCGGGCCATAAAGCACATTGGATATCTCGAGATATCCAATGTGCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145569
VALIDATED
MAT2A MISSION shRNA Lentiviral Transduction Particles
methionine adenosyltransferase II, alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-2014s21c1
Sequence:CCGGTTTGGAGGACGTACGTAATAACTCGAGTTATTACGTACGTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-825s21c1
Sequence:CCGGTACCTTGATGAGGATACAATTCTCGAGAATTGTATCCTCATCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-1215s21c1
Sequence:CCGGGATCTGAAGAAGCCAATTTATCTCGAGATAAATTGGCTTCTTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145569.4-493s21c1
Sequence:CCGGACCGGAATGAGGAAGATATTGCTCGAGCAATATCTTCCTCATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145569.2-1797s1c1
Sequence:CCGGCCTCCCTGTAACTCATTTCTACTCGAGTAGAAATGAGTTACAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-592s1c1
Sequence:CCGGGCACACAAGCTAAATGCCAAACTCGAGTTTGGCATTTAGCTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-1034s1c1
Sequence:CCGGCCCTTGTTAAAGGAGGTCTGTCTCGAGACAGACCTCCTTTAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-724s1c1
Sequence:CCGGCACACGATTGTTATATCTGTTCTCGAGAACAGATATAACAATCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145569.2-379s1c1
Sequence:CCGGGCCATAAAGCACATTGGATATCTCGAGATATCCAATGTGCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005911
VALIDATED
MAT2A MISSION shRNA Bacterial Glycerol Stock
methionine adenosyltransferase II, alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005911.4-1693s21c1
Sequence:CCGGAGTACTTGTAGTTCCACTTATCTCGAGATAAGTGGAACTACAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005911.4-807s21c1
Sequence:CCGGAGCAGTTGTGCCTGCGAAATACTCGAGTATTTCGCAGGCACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005911.4-1069s21c1
Sequence:CCGGGTTCAGGTCTCTTATGCTATTCTCGAGAATAGCATAAGAGACCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005911.4-646s21c1
Sequence:CCGGTGGTTACGCCCTGATTCTAAACTCGAGTTTAGAATCAGGGCGTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005911.4-613s21c1
Sequence:CCGGCTGGCAGAACTACGCCGTAATCTCGAGATTACGGCGTAGTTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-379s1c1
Sequence:CCGGGCTGTTAAACACATTGGATATCTCGAGATATCCAATGTGTTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-1099s1c1
Sequence:CCGGCATCCATTATCTATCTCCATTCTCGAGAATGGAGATAGATAATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-211s1c1
Sequence:CCGGCCAGATAAGATTTGTGACCAACTCGAGTTGGTCACAAATCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-668s1c1
Sequence:CCGGCTCAAGTTACTGTGCAGTATACTCGAGTATACTGCACAGTAACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005911
VALIDATED
MAT2A MISSION shRNA shRNA Plasmid DNA
methionine adenosyltransferase II, alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005911.4-1693s21c1
Sequence:CCGGAGTACTTGTAGTTCCACTTATCTCGAGATAAGTGGAACTACAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005911.4-807s21c1
Sequence:CCGGAGCAGTTGTGCCTGCGAAATACTCGAGTATTTCGCAGGCACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005911.4-1069s21c1
Sequence:CCGGGTTCAGGTCTCTTATGCTATTCTCGAGAATAGCATAAGAGACCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005911.4-646s21c1
Sequence:CCGGTGGTTACGCCCTGATTCTAAACTCGAGTTTAGAATCAGGGCGTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005911.4-613s21c1
Sequence:CCGGCTGGCAGAACTACGCCGTAATCTCGAGATTACGGCGTAGTTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-379s1c1
Sequence:CCGGGCTGTTAAACACATTGGATATCTCGAGATATCCAATGTGTTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-1099s1c1
Sequence:CCGGCATCCATTATCTATCTCCATTCTCGAGAATGGAGATAGATAATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-211s1c1
Sequence:CCGGCCAGATAAGATTTGTGACCAACTCGAGTTGGTCACAAATCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-668s1c1
Sequence:CCGGCTCAAGTTACTGTGCAGTATACTCGAGTATACTGCACAGTAACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005911
VALIDATED
MAT2A MISSION shRNA Lentiviral Transduction Particles
methionine adenosyltransferase II, alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005911.4-1693s21c1
Sequence:CCGGAGTACTTGTAGTTCCACTTATCTCGAGATAAGTGGAACTACAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005911.4-807s21c1
Sequence:CCGGAGCAGTTGTGCCTGCGAAATACTCGAGTATTTCGCAGGCACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005911.4-1069s21c1
Sequence:CCGGGTTCAGGTCTCTTATGCTATTCTCGAGAATAGCATAAGAGACCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005911.4-646s21c1
Sequence:CCGGTGGTTACGCCCTGATTCTAAACTCGAGTTTAGAATCAGGGCGTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005911.4-613s21c1
Sequence:CCGGCTGGCAGAACTACGCCGTAATCTCGAGATTACGGCGTAGTTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-379s1c1
Sequence:CCGGGCTGTTAAACACATTGGATATCTCGAGATATCCAATGTGTTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-1099s1c1
Sequence:CCGGCATCCATTATCTATCTCCATTCTCGAGAATGGAGATAGATAATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-211s1c1
Sequence:CCGGCCAGATAAGATTTGTGACCAACTCGAGTTGGTCACAAATCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005911.4-668s1c1
Sequence:CCGGCTCAAGTTACTGTGCAGTATACTCGAGTATACTGCACAGTAACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks