EMAIL THIS PAGE TO A FRIEND

MAZ

MYC-associated zinc finger protein (purine-binding transcription factor)

Synonyms: PUR1 Pur-1 SAF-1 SAF-2 SAF-3 ZF87 ZNF801 Zif87
Gene ID:
Mouse(17188) MYC-associated zinc finger protein (purine-binding transcription factor)
Rat(691842) MYC-associated zinc finger protein (purine-binding transcription factor)
fruit fly(43914) matzerath
dog(607693) MYC-associated zinc finger protein (purine-binding transcription factor)
domestic cat(101096193) MYC-associated zinc finger protein (purine-binding transcription factor)
cow(100296937) MYC-associated zinc finger protein (purine-binding transcription factor)
domestic guinea pig(100727346) MYC-associated zinc finger protein (purine-binding transcription factor)
Domestic Rabbit(100008693) MYC-associated zinc finger protein (purine-binding transcription factor)
sheep(101101948) MYC-associated zinc finger protein (purine-binding transcription factor)
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412050 ANTI-MAZ antibody produced in mouse clone 6G2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412539 ANTI-MAZ antibody produced in mouse clone 3B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412540 ANTI-MAZ antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2101438 Anti-MAZ antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB2104143 Anti-MAZ antibody produced in rabbit affinity isolated antibody , rabbit, human, guinea pig, rabbit, mouse, rat
western blot pricing
HPA048315 Anti-MAZ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA059495 Anti-MAZ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA065930 Anti-MAZ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2104142 Anti-MAZ, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, human, mouse, rabbit, rat
western blot pricing
WH0004150M1 Monoclonal Anti-MAZ antibody produced in mouse clone 3D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404051 Monoclonal Anti-MAZ antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002383 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042539 Rosetta Predictions human pricing
NM_002383 Rosetta Predictions human pricing
NM_001110319 Rosetta Predictions rat pricing
NM_010772 Rosetta Predictions mouse pricing
XM_001002765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310448 predicted 1212
2 SASI_Hs02_00310449 predicted 1116
3 SASI_Hs02_00310450 predicted 1132
4 SASI_Hs02_00310451 predicted 2002
5 SASI_Hs02_00310452 predicted 1987
6 SASI_Hs02_00310453 predicted 1055
7 SASI_Hs02_00310454 predicted 1197
8 SASI_Hs02_00310455 predicted 1155
9 SASI_Hs02_00310456 predicted 1157
10 SASI_Hs02_00310457 predicted 2006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185564 predicted 1209
2 SASI_Hs01_00185565 predicted 1117
3 SASI_Hs01_00185566 predicted 1134
4 SASI_Hs01_00185567 predicted 1050
5 SASI_Hs02_00333729 predicted 1191
6 SASI_Hs02_00333730 predicted 1154
7 SASI_Hs01_00185568 predicted 1160
8 SASI_Hs01_00185569 predicted 1196
9 SASI_Hs01_00185570 predicted 1125
10 SASI_Hs02_00333731 predicted 1036
11 SASI_Hs01_00185562 predicted 1231
12 SASI_Hs01_00185563 predicted 1237
13 SASI_Hs01_00185571 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251132 predicted 1001
2 SASI_Rn02_00251133 predicted 1038
3 SASI_Rn02_00251134 predicted 1063
4 SASI_Rn02_00251135 predicted 951
5 SASI_Rn02_00251136 predicted 1067
6 SASI_Rn02_00251137 predicted 252
7 SASI_Rn02_00251138 predicted 602
8 SASI_Rn02_00251139 predicted 834
9 SASI_Rn02_00251140 predicted 965
10 SASI_Rn02_00251141 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319311 predicted 1634
2 SASI_Mm02_00319312 predicted 1101
3 SASI_Mm02_00319313 predicted 1120
4 SASI_Mm02_00319314 predicted 1792
5 SASI_Mm02_00319315 predicted 1795
6 SASI_Mm02_00319316 predicted 983
7 SASI_Mm02_00319317 predicted 657
8 SASI_Mm02_00319318 predicted 1646
9 SASI_Mm02_00319319 predicted 583
10 SASI_Mm02_00319320 predicted 1793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248834 predicted 2103
2 SASI_Mm01_00248835 predicted 1339
3 SASI_Mm01_00248836 predicted 1495
4 SASI_Mm01_00248837 predicted 1361
5 SASI_Mm01_00248838 predicted 1383
6 SASI_Mm01_00248839 predicted 2252
7 SASI_Mm01_00248840 predicted 2263
8 SASI_Mm01_00248841 predicted 1219
9 SASI_Mm01_00248842 predicted 893
10 SASI_Mm01_00248843 predicted 2111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010772
VALIDATED
MAZ MISSION shRNA Bacterial Glycerol Stock
MYC-associated zinc finger protein (purine-binding transcription factor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-1257s21c1
Sequence:CCGGGATGCTGAGCTCGGCTTATATCTCGAGATATAAGCCGAGCTCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-2011s21c1
Sequence:CCGGGAGTAAGGTTGGGTGGTTAAACTCGAGTTTAACCACCCAACCTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010772.1-933s21c1
Sequence:CCGGCTACCACCTGAACCGACATAACTCGAGTTATGTCGGTTCAGGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-1151s21c1
Sequence:CCGGGGCCCTTCAAATGTGAGAAATCTCGAGATTTCTCACATTTGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-1319s21c1
Sequence:CCGGTCTGTGAGCTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGCTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010772
VALIDATED
MAZ MISSION shRNA shRNA Plasmid DNA
MYC-associated zinc finger protein (purine-binding transcription factor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-1257s21c1
Sequence:CCGGGATGCTGAGCTCGGCTTATATCTCGAGATATAAGCCGAGCTCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-2011s21c1
Sequence:CCGGGAGTAAGGTTGGGTGGTTAAACTCGAGTTTAACCACCCAACCTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010772.1-933s21c1
Sequence:CCGGCTACCACCTGAACCGACATAACTCGAGTTATGTCGGTTCAGGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-1151s21c1
Sequence:CCGGGGCCCTTCAAATGTGAGAAATCTCGAGATTTCTCACATTTGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-1319s21c1
Sequence:CCGGTCTGTGAGCTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGCTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010772
VALIDATED
MAZ MISSION shRNA Lentiviral Transduction Particles
MYC-associated zinc finger protein (purine-binding transcription factor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-1257s21c1
Sequence:CCGGGATGCTGAGCTCGGCTTATATCTCGAGATATAAGCCGAGCTCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-2011s21c1
Sequence:CCGGGAGTAAGGTTGGGTGGTTAAACTCGAGTTTAACCACCCAACCTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010772.1-933s21c1
Sequence:CCGGCTACCACCTGAACCGACATAACTCGAGTTATGTCGGTTCAGGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-1151s21c1
Sequence:CCGGGGCCCTTCAAATGTGAGAAATCTCGAGATTTCTCACATTTGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010772.1-1319s21c1
Sequence:CCGGTCTGTGAGCTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGCTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002383
VALIDATED
MAZ MISSION shRNA Bacterial Glycerol Stock
MYC-associated zinc finger protein (purine-binding transcription factor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-1427s21c1
Sequence:CCGGTCTGTGAGCTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGCTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-703s21c1
Sequence:CCGGGCCTTGGAGAAGAAGACAAAGCTCGAGCTTTGTCTTCTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-761s21c1
Sequence:CCGGAGTTCAAGAACGGCTACAATCCTCGAGGATTGTAGCCGTTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-1675s21c1
Sequence:CCGGTTTCCCACCAACTCCTATTTCCTCGAGGAAATAGGAGTTGGTGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-1365s21c1
Sequence:CCGGGATGCTGAGCTCGGCTTATATCTCGAGATATAAGCCGAGCTCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-761s1c1
Sequence:CCGGGAGTTCAAGAACGGCTACAATCTCGAGATTGTAGCCGTTCTTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-164s1c1
Sequence:CCGGGAGGCCATGTTCCCGGTGTTTCTCGAGAAACACCGGGAACATGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-1374s1c1
Sequence:CCGGCGGCTTATATTTCGGACCACACTCGAGTGTGGTCCGAAATATAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-1256s1c1
Sequence:CCGGCGGCCCTTCAAATGTGAGAAACTCGAGTTTCTCACATTTGAAGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002383.1-1587s1c1
Sequence:CCGGCTCCAAGTTGGTTGCGGGGGACTCGAGTCCCCCGCAACCAACTTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002383
VALIDATED
MAZ MISSION shRNA shRNA Plasmid DNA
MYC-associated zinc finger protein (purine-binding transcription factor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-1427s21c1
Sequence:CCGGTCTGTGAGCTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGCTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-703s21c1
Sequence:CCGGGCCTTGGAGAAGAAGACAAAGCTCGAGCTTTGTCTTCTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-761s21c1
Sequence:CCGGAGTTCAAGAACGGCTACAATCCTCGAGGATTGTAGCCGTTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-1675s21c1
Sequence:CCGGTTTCCCACCAACTCCTATTTCCTCGAGGAAATAGGAGTTGGTGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-1365s21c1
Sequence:CCGGGATGCTGAGCTCGGCTTATATCTCGAGATATAAGCCGAGCTCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-761s1c1
Sequence:CCGGGAGTTCAAGAACGGCTACAATCTCGAGATTGTAGCCGTTCTTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-164s1c1
Sequence:CCGGGAGGCCATGTTCCCGGTGTTTCTCGAGAAACACCGGGAACATGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-1374s1c1
Sequence:CCGGCGGCTTATATTTCGGACCACACTCGAGTGTGGTCCGAAATATAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-1256s1c1
Sequence:CCGGCGGCCCTTCAAATGTGAGAAACTCGAGTTTCTCACATTTGAAGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002383.1-1587s1c1
Sequence:CCGGCTCCAAGTTGGTTGCGGGGGACTCGAGTCCCCCGCAACCAACTTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002383
VALIDATED
MAZ MISSION shRNA Lentiviral Transduction Particles
MYC-associated zinc finger protein (purine-binding transcription factor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-1427s21c1
Sequence:CCGGTCTGTGAGCTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGCTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-703s21c1
Sequence:CCGGGCCTTGGAGAAGAAGACAAAGCTCGAGCTTTGTCTTCTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-761s21c1
Sequence:CCGGAGTTCAAGAACGGCTACAATCCTCGAGGATTGTAGCCGTTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-1675s21c1
Sequence:CCGGTTTCCCACCAACTCCTATTTCCTCGAGGAAATAGGAGTTGGTGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002383.2-1365s21c1
Sequence:CCGGGATGCTGAGCTCGGCTTATATCTCGAGATATAAGCCGAGCTCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-761s1c1
Sequence:CCGGGAGTTCAAGAACGGCTACAATCTCGAGATTGTAGCCGTTCTTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-164s1c1
Sequence:CCGGGAGGCCATGTTCCCGGTGTTTCTCGAGAAACACCGGGAACATGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-1374s1c1
Sequence:CCGGCGGCTTATATTTCGGACCACACTCGAGTGTGGTCCGAAATATAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002383.1-1256s1c1
Sequence:CCGGCGGCCCTTCAAATGTGAGAAACTCGAGTTTCTCACATTTGAAGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002383.1-1587s1c1
Sequence:CCGGCTCCAAGTTGGTTGCGGGGGACTCGAGTCCCCCGCAACCAACTTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks