EMAIL THIS PAGE TO A FRIEND

MBD2

methyl-CpG binding domain protein 2

Synonyms: DMTase NY-CO-41
UniProtKB ID: Q9UBB5, O95242, Q9UIS8
Gene ID:
Human(8932) Summary: DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. The protein encoded by this gene may function as a mediator of the biological consequences of the methylation signal. It is also reported that the this protein functions as a demethylase to activate transcription, as DNA methylation causes gene silencing. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Mouse(17191) methyl-CpG binding domain protein 2
Rat(680172) methyl-CpG binding domain protein 2
Zebrafish(337105) methyl-CpG binding domain protein 2
chicken(497269) methyl-CpG binding domain protein 2
cow(100337206) methyl-CpG binding domain protein 2
domestic cat(101096114) methyl-CpG binding domain protein 2
dog(483975) methyl-CpG binding domain protein 2
naked mole-rat(101707030) methyl-CpG binding domain protein 2
domestic guinea pig(100735208) methyl-CpG binding domain protein 2
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32484 Anti-COLEC12 (AB1) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rat, human, rabbit
western blot pricing
SAB2500619 Anti-MBD2 (Isoform 1) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human, canine
ELISA, immunohistochemistry, western blot pricing
AV40169 Anti-MBD2 antibody produced in rabbit IgG fraction of antiserum canine, rat, horse, human, mouse, guinea pig, zebrafish, rabbit, bovine
western blot pricing
SAB2101440 Anti-MBD2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
HPA067582 Anti-MBD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA067615 Anti-MBD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
M7568 Anti-MBD2a antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
microarray, western blot pricing
M7318 Anti-MBD2a,b (RA-18) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, microarray, western blot pricing
GW22664 Anti-methyl-CpG binding domain protein antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU036091 MISSION® esiRNA esiRNA targeting mouse Mbd2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003927 Rosetta Predictions human pricing
NM_015832 Rosetta Predictions human pricing
NM_001115025 Rosetta Predictions rat pricing
NM_010773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234856 predicted 1266
2 SASI_Hs01_00234857 predicted 1384
3 SASI_Hs01_00234858 predicted 854
4 SASI_Hs01_00234859 predicted 824
5 SASI_Hs02_00336577 predicted 1099
6 SASI_Hs01_00234860 predicted 1092
7 SASI_Hs01_00234861 predicted 1029
8 SASI_Hs01_00234862 predicted 1128
9 SASI_Hs01_00234863 predicted 897
10 SASI_Hs01_00234864 predicted 1209
11 SASI_Hs01_00234865 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101818 predicted 855
2 SASI_Hs01_00101820 predicted 899
3 SASI_Hs01_00101822 predicted 819
4 SASI_Hs01_00101823 predicted 738
5 SASI_Hs02_00348419 predicted 889
6 SASI_Hs01_00101824 predicted 1275
7 SASI_Hs01_00101825 predicted 851
8 SASI_Hs02_00348420 predicted 766
9 SASI_Hs01_00101826 predicted 769
10 SASI_Hs02_00348421 predicted 763
11 SASI_Hs01_00101817 predicted 1255
12 SASI_Hs01_00101819 predicted 1237
13 SASI_Hs01_00101821 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252423 predicted 1050
2 SASI_Rn02_00252424 predicted 605
3 SASI_Rn02_00252425 predicted 1161
4 SASI_Rn02_00252426 predicted 1282
5 SASI_Rn02_00252427 predicted 1281
6 SASI_Rn02_00252428 predicted 590
7 SASI_Rn02_00252429 predicted 880
8 SASI_Rn02_00252430 predicted 721
9 SASI_Rn02_00252431 predicted 1209
10 SASI_Rn02_00252432 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064481 predicted 1020
2 SASI_Mm01_00064482 predicted 1273
3 SASI_Mm01_00064483 predicted 952
4 SASI_Mm01_00064484 predicted 1361
5 SASI_Mm01_00064485 predicted 991
6 SASI_Mm01_00064486 predicted 1506
7 SASI_Mm01_00064487 predicted 1105
8 SASI_Mm01_00064488 predicted 1455
9 SASI_Mm01_00064489 predicted 1436
10 SASI_Mm01_00064490 predicted 1486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003927
VALIDATED
MBD2 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003927.3-2410s1c1
Sequence:CCGGGCTTAATGAAAGGGTTTGTAACTCGAGTTACAAACCCTTTCATTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-1364s1c1
Sequence:CCGGGTACGCAAGAAATTGGAAGAACTCGAGTTCTTCCAATTTCTTGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-943s1c1
Sequence:CCGGCTTGAATACAACATTGCCAATCTCGAGATTGGCAATGTTGTATTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-1173s1c1
Sequence:CCGGGTAGCAATGATGAGACCCTTTCTCGAGAAAGGGTCTCATCATTGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-871s1c1
Sequence:CCGGGCCTAGTAAATTACAGAAGAACTCGAGTTCTTCTGTAATTTACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003927.3-943s21c1
Sequence:CCGGCTTGAATACAACATTGCCAATCTCGAGATTGGCAATGTTGTATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003927.3-871s21c1
Sequence:CCGGGCCTAGTAAATTACAGAAGAACTCGAGTTCTTCTGTAATTTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003927.3-1364s21c1
Sequence:CCGGGTACGCAAGAAATTGGAAGAACTCGAGTTCTTCCAATTTCTTGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003927.3-1173s21c1
Sequence:CCGGGTAGCAATGATGAGACCCTTTCTCGAGAAAGGGTCTCATCATTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003927.3-1477s21c1
Sequence:GTACCGGGGTAACTTTCGACCGACTTTCCTCGAGGAAAGTCGGTCGAAAGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003927.3-1753s21c1
Sequence:GTACCGGGAAATGTAGCACTTACGTAAACTCGAGTTTACGTAAGTGCTACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003927
VALIDATED
MBD2 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003927.3-2410s1c1
Sequence:CCGGGCTTAATGAAAGGGTTTGTAACTCGAGTTACAAACCCTTTCATTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-1364s1c1
Sequence:CCGGGTACGCAAGAAATTGGAAGAACTCGAGTTCTTCCAATTTCTTGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-943s1c1
Sequence:CCGGCTTGAATACAACATTGCCAATCTCGAGATTGGCAATGTTGTATTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-1173s1c1
Sequence:CCGGGTAGCAATGATGAGACCCTTTCTCGAGAAAGGGTCTCATCATTGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-871s1c1
Sequence:CCGGGCCTAGTAAATTACAGAAGAACTCGAGTTCTTCTGTAATTTACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003927.3-943s21c1
Sequence:CCGGCTTGAATACAACATTGCCAATCTCGAGATTGGCAATGTTGTATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003927.3-871s21c1
Sequence:CCGGGCCTAGTAAATTACAGAAGAACTCGAGTTCTTCTGTAATTTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003927.3-1364s21c1
Sequence:CCGGGTACGCAAGAAATTGGAAGAACTCGAGTTCTTCCAATTTCTTGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003927.3-1173s21c1
Sequence:CCGGGTAGCAATGATGAGACCCTTTCTCGAGAAAGGGTCTCATCATTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003927.3-1477s21c1
Sequence:GTACCGGGGTAACTTTCGACCGACTTTCCTCGAGGAAAGTCGGTCGAAAGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003927.3-1753s21c1
Sequence:GTACCGGGAAATGTAGCACTTACGTAAACTCGAGTTTACGTAAGTGCTACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003927
VALIDATED
MBD2 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003927.3-2410s1c1
Sequence:CCGGGCTTAATGAAAGGGTTTGTAACTCGAGTTACAAACCCTTTCATTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-1364s1c1
Sequence:CCGGGTACGCAAGAAATTGGAAGAACTCGAGTTCTTCCAATTTCTTGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-943s1c1
Sequence:CCGGCTTGAATACAACATTGCCAATCTCGAGATTGGCAATGTTGTATTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-1173s1c1
Sequence:CCGGGTAGCAATGATGAGACCCTTTCTCGAGAAAGGGTCTCATCATTGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003927.3-871s1c1
Sequence:CCGGGCCTAGTAAATTACAGAAGAACTCGAGTTCTTCTGTAATTTACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003927.3-943s21c1
Sequence:CCGGCTTGAATACAACATTGCCAATCTCGAGATTGGCAATGTTGTATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003927.3-871s21c1
Sequence:CCGGGCCTAGTAAATTACAGAAGAACTCGAGTTCTTCTGTAATTTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003927.3-1364s21c1
Sequence:CCGGGTACGCAAGAAATTGGAAGAACTCGAGTTCTTCCAATTTCTTGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003927.3-1173s21c1
Sequence:CCGGGTAGCAATGATGAGACCCTTTCTCGAGAAAGGGTCTCATCATTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003927.3-1477s21c1
Sequence:GTACCGGGGTAACTTTCGACCGACTTTCCTCGAGGAAAGTCGGTCGAAAGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003927.3-1753s21c1
Sequence:GTACCGGGAAATGTAGCACTTACGTAAACTCGAGTTTACGTAAGTGCTACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010773
MBD2 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-868s1c1
Sequence:CCGGCGGCAAGATGATGCCTAGTAACTCGAGTTACTAGGCATCATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-952s1c1
Sequence:CCGGCCTGAACACAACATTGCCAATCTCGAGATTGGCAATGTTGTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-1355s1c1
Sequence:CCGGGAAGAGCGAGTCCAACAAGTACTCGAGTACTTGTTGGACTCGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-1055s1c1
Sequence:CCGGCGGATGAATGAACAACCACGTCTCGAGACGTGGTTGTTCATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-1286s1c1
Sequence:CCGGGTTTGGCTTAACACATCTCAACTCGAGTTGAGATGTGTTAAGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010773.2-1405s21c1
Sequence:CCGGCAAGAGCAAATTGCTAGAAACCTCGAGGTTTCTAGCAATTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010773.2-823s21c1
Sequence:CCGGTCAATCAGAACAAGGGTAAACCTCGAGGTTTACCCTTGTTCTGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010773.2-1371s21c1
Sequence:CCGGGAATATGATCAGGTAACTTTCCTCGAGGAAAGTTACCTGATCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010773.2-1655s21c1
Sequence:CCGGAGGTAGCACTTACGTGAAATACTCGAGTATTTCACGTAAGTGCTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010773
MBD2 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-868s1c1
Sequence:CCGGCGGCAAGATGATGCCTAGTAACTCGAGTTACTAGGCATCATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-952s1c1
Sequence:CCGGCCTGAACACAACATTGCCAATCTCGAGATTGGCAATGTTGTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-1355s1c1
Sequence:CCGGGAAGAGCGAGTCCAACAAGTACTCGAGTACTTGTTGGACTCGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-1055s1c1
Sequence:CCGGCGGATGAATGAACAACCACGTCTCGAGACGTGGTTGTTCATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-1286s1c1
Sequence:CCGGGTTTGGCTTAACACATCTCAACTCGAGTTGAGATGTGTTAAGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010773.2-1405s21c1
Sequence:CCGGCAAGAGCAAATTGCTAGAAACCTCGAGGTTTCTAGCAATTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010773.2-823s21c1
Sequence:CCGGTCAATCAGAACAAGGGTAAACCTCGAGGTTTACCCTTGTTCTGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010773.2-1371s21c1
Sequence:CCGGGAATATGATCAGGTAACTTTCCTCGAGGAAAGTTACCTGATCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010773.2-1655s21c1
Sequence:CCGGAGGTAGCACTTACGTGAAATACTCGAGTATTTCACGTAAGTGCTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010773
MBD2 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-868s1c1
Sequence:CCGGCGGCAAGATGATGCCTAGTAACTCGAGTTACTAGGCATCATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-952s1c1
Sequence:CCGGCCTGAACACAACATTGCCAATCTCGAGATTGGCAATGTTGTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-1355s1c1
Sequence:CCGGGAAGAGCGAGTCCAACAAGTACTCGAGTACTTGTTGGACTCGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-1055s1c1
Sequence:CCGGCGGATGAATGAACAACCACGTCTCGAGACGTGGTTGTTCATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010773.1-1286s1c1
Sequence:CCGGGTTTGGCTTAACACATCTCAACTCGAGTTGAGATGTGTTAAGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010773.2-1405s21c1
Sequence:CCGGCAAGAGCAAATTGCTAGAAACCTCGAGGTTTCTAGCAATTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010773.2-823s21c1
Sequence:CCGGTCAATCAGAACAAGGGTAAACCTCGAGGTTTACCCTTGTTCTGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010773.2-1371s21c1
Sequence:CCGGGAATATGATCAGGTAACTTTCCTCGAGGAAAGTTACCTGATCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010773.2-1655s21c1
Sequence:CCGGAGGTAGCACTTACGTGAAATACTCGAGTATTTCACGTAAGTGCTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks