EMAIL THIS PAGE TO A FRIEND

MBD3

methyl-CpG binding domain protein 3

UniProtKB ID: O95983, A8K4B7, D6W5Z2, Q6PIL9, Q6PJZ9, Q86XF4
Gene ID:
Human(53615) Summary: DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). However, unlike the other family members, MBD3 is not capable of binding to methylated DNA. The predicted MBD3 protein shares 71% and 94% identity with MBD2 (isoform 1) and mouse Mbd3. MBD3 is a subunit of the NuRD, a multisubunit complex containing nucleosome remodeling and histone deacetylase activities. MBD3 mediates the association of metastasis-associated protein 2 (MTA2) with the core histone deacetylase complex. [provided by RefSeq, Jul 2008]
Mouse(17192) methyl-CpG binding domain protein 3
Rat(362834) methyl-CpG binding domain protein 3
domestic guinea pig(100713224) methyl-CpG binding domain protein 3
naked mole-rat(101696358) methyl-CpG binding domain protein 3
sheep(101119469) methyl-CpG binding domain protein 3
Thale Cress(828069) methyl-CpG-binding domain-containing protein 3
chicken(770153) methyl-CpG binding domain protein 3
domestic cat(101098692) methyl-CpG binding domain protein 3
cow(616090) methyl-CpG binding domain protein 3
dog(485080) methyl-CpG binding domain protein 3
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003926 Rosetta Predictions human pricing
NM_001108735 Rosetta Predictions rat pricing
NM_013595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157891 predicted 448
2 SASI_Hs01_00157892 predicted 1297
3 SASI_Hs01_00157893 predicted 373
4 SASI_Hs01_00157894 predicted 269
5 SASI_Hs01_00157895 predicted 625
6 SASI_Hs01_00157896 predicted 183
7 SASI_Hs01_00157897 predicted 1803
8 SASI_Hs01_00157898 predicted 2081
9 SASI_Hs01_00157899 predicted 1445
10 SASI_Hs02_00336576 predicted 1667
11 SASI_Hs01_00157900 predicted 1659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241565 predicted 727
2 SASI_Rn02_00241566 predicted 1506
3 SASI_Rn02_00241567 predicted 1337
4 SASI_Rn02_00241568 predicted 493
5 SASI_Rn02_00241569 predicted 656
6 SASI_Rn02_00241570 predicted 736
7 SASI_Rn02_00241571 predicted 596
8 SASI_Rn02_00241572 predicted 554
9 SASI_Rn02_00241573 predicted 579
10 SASI_Rn02_00241574 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033186 predicted 1302
2 SASI_Mm01_00033187 predicted 552
3 SASI_Mm01_00033188 predicted 550
4 SASI_Mm01_00033189 predicted 673
5 SASI_Mm01_00033190 predicted 439
6 SASI_Mm01_00033191 predicted 446
7 SASI_Mm01_00033192 predicted 601
8 SASI_Mm01_00033193 predicted 535
9 SASI_Mm01_00033194 predicted 779
10 SASI_Mm01_00033195 predicted 781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003926
VALIDATED
MBD3 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003926.5-380s21c1
Sequence:CCGGAGCAACAAGGTCAAGAGCGACCTCGAGGTCGCTCTTGACCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003926.5-952s21c1
Sequence:CCGGGACTGCCTGGTGAACACAGATCTCGAGATCTGTGTTCACCAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-352s21c1
Sequence:CCGGGCCGGTGACCAAGATTACCAACTCGAGTTGGTAATCTTGGTCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-454s21c1
Sequence:CCGGCGGCCTGAACGCCTTCGACATCTCGAGATGTCGAAGGCGTTCAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003926.5-124s21c1
Sequence:CCGGTTACTATAGCCCGAGCGGGAACTCGAGTTCCCGCTCGGGCTATAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-194s21c1
Sequence:CCGGGACCTGAGCACCTTCGACTTCCTCGAGGAAGTCGAAGGTGCTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003926.5-1000s21c1
Sequence:CCGGGAGCTTCCCATCTCCCTAGAACTCGAGTTCTAGGGAGATGGGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-223s21c1
Sequence:CCGGCAAGATGCTGATGAGCAAGATCTCGAGATCTTGCTCATCAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-352s1c1
Sequence:CCGGGCCGGTGACCAAGATTACCAACTCGAGTTGGTAATCTTGGTCACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-271s1c1
Sequence:CCGGCGACTCCTCCAACCAGGTCAACTCGAGTTGACCTGGTTGGAGGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-571s1c1
Sequence:CCGGCGCCCTGCACACTAGCACCATCTCGAGATGGTGCTAGTGTGCAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003926.5-661s1c1
Sequence:CCGGCCTGTGCAAAGCCTTCATGGTCTCGAGACCATGAAGGCTTTGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-454s1c1
Sequence:CCGGCGGCCTGAACGCCTTCGACATCTCGAGATGTCGAAGGCGTTCAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003926
VALIDATED
MBD3 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003926.5-380s21c1
Sequence:CCGGAGCAACAAGGTCAAGAGCGACCTCGAGGTCGCTCTTGACCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003926.5-952s21c1
Sequence:CCGGGACTGCCTGGTGAACACAGATCTCGAGATCTGTGTTCACCAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-352s21c1
Sequence:CCGGGCCGGTGACCAAGATTACCAACTCGAGTTGGTAATCTTGGTCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-454s21c1
Sequence:CCGGCGGCCTGAACGCCTTCGACATCTCGAGATGTCGAAGGCGTTCAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003926.5-124s21c1
Sequence:CCGGTTACTATAGCCCGAGCGGGAACTCGAGTTCCCGCTCGGGCTATAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-194s21c1
Sequence:CCGGGACCTGAGCACCTTCGACTTCCTCGAGGAAGTCGAAGGTGCTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003926.5-1000s21c1
Sequence:CCGGGAGCTTCCCATCTCCCTAGAACTCGAGTTCTAGGGAGATGGGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-223s21c1
Sequence:CCGGCAAGATGCTGATGAGCAAGATCTCGAGATCTTGCTCATCAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-352s1c1
Sequence:CCGGGCCGGTGACCAAGATTACCAACTCGAGTTGGTAATCTTGGTCACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-271s1c1
Sequence:CCGGCGACTCCTCCAACCAGGTCAACTCGAGTTGACCTGGTTGGAGGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-571s1c1
Sequence:CCGGCGCCCTGCACACTAGCACCATCTCGAGATGGTGCTAGTGTGCAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003926.5-661s1c1
Sequence:CCGGCCTGTGCAAAGCCTTCATGGTCTCGAGACCATGAAGGCTTTGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-454s1c1
Sequence:CCGGCGGCCTGAACGCCTTCGACATCTCGAGATGTCGAAGGCGTTCAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003926
VALIDATED
MBD3 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003926.5-380s21c1
Sequence:CCGGAGCAACAAGGTCAAGAGCGACCTCGAGGTCGCTCTTGACCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003926.5-952s21c1
Sequence:CCGGGACTGCCTGGTGAACACAGATCTCGAGATCTGTGTTCACCAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-352s21c1
Sequence:CCGGGCCGGTGACCAAGATTACCAACTCGAGTTGGTAATCTTGGTCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-454s21c1
Sequence:CCGGCGGCCTGAACGCCTTCGACATCTCGAGATGTCGAAGGCGTTCAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003926.5-124s21c1
Sequence:CCGGTTACTATAGCCCGAGCGGGAACTCGAGTTCCCGCTCGGGCTATAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-194s21c1
Sequence:CCGGGACCTGAGCACCTTCGACTTCCTCGAGGAAGTCGAAGGTGCTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003926.5-1000s21c1
Sequence:CCGGGAGCTTCCCATCTCCCTAGAACTCGAGTTCTAGGGAGATGGGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003926.5-223s21c1
Sequence:CCGGCAAGATGCTGATGAGCAAGATCTCGAGATCTTGCTCATCAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-352s1c1
Sequence:CCGGGCCGGTGACCAAGATTACCAACTCGAGTTGGTAATCTTGGTCACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-271s1c1
Sequence:CCGGCGACTCCTCCAACCAGGTCAACTCGAGTTGACCTGGTTGGAGGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-571s1c1
Sequence:CCGGCGCCCTGCACACTAGCACCATCTCGAGATGGTGCTAGTGTGCAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003926.5-661s1c1
Sequence:CCGGCCTGTGCAAAGCCTTCATGGTCTCGAGACCATGAAGGCTTTGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003926.5-454s1c1
Sequence:CCGGCGGCCTGAACGCCTTCGACATCTCGAGATGTCGAAGGCGTTCAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013595
VALIDATED
MBD3 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-787s21c1
Sequence:CCGGCCATTGCGAGTGCTCTACACACTCGAGTGTGTAGAGCACTCGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013595.2-554s21c1
Sequence:CCGGGCAGACTGCATCCATCTTCAACTCGAGTTGAAGATGGATGCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-675s21c1
Sequence:CCGGCTAAGTGGATTGAGTGCCTTTCTCGAGAAAGGCACTCAATCCACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-1348s21c1
Sequence:CCGGCTCCCTGCCTCCTTATCATAGCTCGAGCTATGATAAGGAGGCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-978s21c1
Sequence:CCGGATGGCCGACATGCTAGCTCATCTCGAGATGAGCTAGCATGTCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-1306s21c1
Sequence:CCGGATGAGCAGTGACCCAACTGAGCTCGAGCTCAGTTGGGTCACTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013595.1-554s1c1
Sequence:CCGGGCAGACTGCATCCATCTTCAACTCGAGTTGAAGATGGATGCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013595.1-491s1c1
Sequence:CCGGGCGCTATGATTCTTCCAACCACTCGAGTGGTTGGAAGAATCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013595.1-904s1c1
Sequence:CCGGTGGTGACAGATGACGACATCACTCGAGTGATGTCGTCATCTGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013595.1-443s1c1
Sequence:CCGGCACCGGAAAGATGTTGATGAACTCGAGTTCATCAACATCTTTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013595
VALIDATED
MBD3 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-787s21c1
Sequence:CCGGCCATTGCGAGTGCTCTACACACTCGAGTGTGTAGAGCACTCGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013595.2-554s21c1
Sequence:CCGGGCAGACTGCATCCATCTTCAACTCGAGTTGAAGATGGATGCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-675s21c1
Sequence:CCGGCTAAGTGGATTGAGTGCCTTTCTCGAGAAAGGCACTCAATCCACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-1348s21c1
Sequence:CCGGCTCCCTGCCTCCTTATCATAGCTCGAGCTATGATAAGGAGGCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-978s21c1
Sequence:CCGGATGGCCGACATGCTAGCTCATCTCGAGATGAGCTAGCATGTCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-1306s21c1
Sequence:CCGGATGAGCAGTGACCCAACTGAGCTCGAGCTCAGTTGGGTCACTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013595.1-554s1c1
Sequence:CCGGGCAGACTGCATCCATCTTCAACTCGAGTTGAAGATGGATGCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013595.1-491s1c1
Sequence:CCGGGCGCTATGATTCTTCCAACCACTCGAGTGGTTGGAAGAATCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013595.1-904s1c1
Sequence:CCGGTGGTGACAGATGACGACATCACTCGAGTGATGTCGTCATCTGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013595.1-443s1c1
Sequence:CCGGCACCGGAAAGATGTTGATGAACTCGAGTTCATCAACATCTTTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013595
VALIDATED
MBD3 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-787s21c1
Sequence:CCGGCCATTGCGAGTGCTCTACACACTCGAGTGTGTAGAGCACTCGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013595.2-554s21c1
Sequence:CCGGGCAGACTGCATCCATCTTCAACTCGAGTTGAAGATGGATGCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-675s21c1
Sequence:CCGGCTAAGTGGATTGAGTGCCTTTCTCGAGAAAGGCACTCAATCCACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-1348s21c1
Sequence:CCGGCTCCCTGCCTCCTTATCATAGCTCGAGCTATGATAAGGAGGCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-978s21c1
Sequence:CCGGATGGCCGACATGCTAGCTCATCTCGAGATGAGCTAGCATGTCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013595.2-1306s21c1
Sequence:CCGGATGAGCAGTGACCCAACTGAGCTCGAGCTCAGTTGGGTCACTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013595.1-554s1c1
Sequence:CCGGGCAGACTGCATCCATCTTCAACTCGAGTTGAAGATGGATGCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013595.1-491s1c1
Sequence:CCGGGCGCTATGATTCTTCCAACCACTCGAGTGGTTGGAAGAATCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013595.1-904s1c1
Sequence:CCGGTGGTGACAGATGACGACATCACTCGAGTGATGTCGTCATCTGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013595.1-443s1c1
Sequence:CCGGCACCGGAAAGATGTTGATGAACTCGAGTTCATCAACATCTTTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks