EMAIL THIS PAGE TO A FRIEND

MBD3L2

methyl-CpG binding domain protein 3-like 2

UniProtKB ID: Q8NHZ7
Gene ID:
Human(125997) Summary: This gene encodes a protein that is related to methyl-CpG-binding proteins but lacks the methyl-CpG binding domain. The protein has been found in germ cell tumors and some somatic tissues. [provided by RefSeq, Jul 2008]
Mouse(234988) methyl-CpG binding domain protein 3-like 2
Rat(300375) methyl-CpG binding domain protein 3-like 2
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302198 ANTI-MBD3L2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144614 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144614 Rosetta Predictions human pricing
XM_001075118 Rosetta Predictions rat pricing
XM_235852 Rosetta Predictions rat pricing
NM_144934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364426 predicted 337
2 SASI_Hs02_00364427 predicted 280
3 SASI_Hs02_00364428 predicted 224
4 SASI_Hs02_00364429 predicted 393
5 SASI_Hs02_00364430 predicted 522
6 SASI_Hs02_00364431 predicted 356
7 SASI_Hs02_00364432 predicted 346
8 SASI_Hs02_00364433 predicted 360
9 SASI_Hs02_00364434 predicted 355
10 SASI_Hs02_00364435 predicted 360
11 SASI_Hs01_00018975 predicted 647
12 SASI_Hs01_00018976 predicted 677
13 SASI_Hs01_00018977 predicted 670
14 SASI_Hs01_00018978 predicted 673
15 SASI_Hs01_00018979 predicted 651
16 SASI_Hs01_00018980 predicted 708
17 SASI_Hs01_00018981 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348531 predicted 244
2 SASI_Rn02_00348532 predicted 272
3 SASI_Rn02_00348533 predicted 244
4 SASI_Rn02_00348534 predicted 279
5 SASI_Rn02_00348535 predicted 354
6 SASI_Rn02_00348536 predicted 256
7 SASI_Rn02_00348537 predicted 330
8 SASI_Rn02_00348538 predicted 327
9 SASI_Rn02_00348539 predicted 322
10 SASI_Rn02_00348540 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389696 predicted 246
2 SASI_Rn02_00389697 predicted 275
3 SASI_Rn02_00389698 predicted 239
4 SASI_Rn02_00389699 predicted 286
5 SASI_Rn02_00389700 predicted 352
6 SASI_Rn02_00389701 predicted 259
7 SASI_Rn02_00389702 predicted 338
8 SASI_Rn02_00389703 predicted 321
9 SASI_Rn02_00389704 predicted 316
10 SASI_Rn02_00389705 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066388 predicted 595
2 SASI_Mm02_00340458 predicted 236
3 SASI_Mm01_00066389 predicted 554
4 SASI_Mm01_00066390 predicted 605
5 SASI_Mm01_00066391 predicted 385
6 SASI_Mm01_00066392 predicted 575
7 SASI_Mm01_00066393 predicted 579
8 SASI_Mm01_00066394 predicted 235
9 SASI_Mm01_00066395 predicted 520
10 SASI_Mm01_00066396 predicted 324
11 SASI_Mm01_00066397 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144934
MBD3L2 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 3-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144934.3-1292s21c1
Sequence:CCGGAGCAAAGGATAAGCCTTAAATCTCGAGATTTAAGGCTTATCCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144934.3-1182s21c1
Sequence:CCGGGTTTCCAGTTTGGATCGAAATCTCGAGATTTCGATCCAAACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144934.3-805s21c1
Sequence:CCGGAGTCAGATCTGGAAGGTAAAGCTCGAGCTTTACCTTCCAGATCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144934.3-550s21c1
Sequence:CCGGTGTCAATTGAAGCTTACAAACCTCGAGGTTTGTAAGCTTCAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-305s1c1
Sequence:CCGGCCAAACATAGAACTGGTGTTACTCGAGTAACACCAGTTCTATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-393s1c1
Sequence:CCGGCCCTGAGAATGAAACCAGGTACTCGAGTACCTGGTTTCATTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-741s1c1
Sequence:CCGGAGAAGTAACTATTGCAGACATCTCGAGATGTCTGCAATAGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-559s1c1
Sequence:CCGGCGGGATGAAACTAATGACCAACTCGAGTTGGTCATTAGTTTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-724s1c1
Sequence:CCGGCCATCTTACTTCATCCAAGAACTCGAGTTCTTGGATGAAGTAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144934
MBD3L2 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 3-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144934.3-1292s21c1
Sequence:CCGGAGCAAAGGATAAGCCTTAAATCTCGAGATTTAAGGCTTATCCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144934.3-1182s21c1
Sequence:CCGGGTTTCCAGTTTGGATCGAAATCTCGAGATTTCGATCCAAACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144934.3-805s21c1
Sequence:CCGGAGTCAGATCTGGAAGGTAAAGCTCGAGCTTTACCTTCCAGATCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144934.3-550s21c1
Sequence:CCGGTGTCAATTGAAGCTTACAAACCTCGAGGTTTGTAAGCTTCAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-305s1c1
Sequence:CCGGCCAAACATAGAACTGGTGTTACTCGAGTAACACCAGTTCTATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-393s1c1
Sequence:CCGGCCCTGAGAATGAAACCAGGTACTCGAGTACCTGGTTTCATTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-741s1c1
Sequence:CCGGAGAAGTAACTATTGCAGACATCTCGAGATGTCTGCAATAGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-559s1c1
Sequence:CCGGCGGGATGAAACTAATGACCAACTCGAGTTGGTCATTAGTTTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-724s1c1
Sequence:CCGGCCATCTTACTTCATCCAAGAACTCGAGTTCTTGGATGAAGTAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144934
MBD3L2 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 3-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144934.3-1292s21c1
Sequence:CCGGAGCAAAGGATAAGCCTTAAATCTCGAGATTTAAGGCTTATCCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144934.3-1182s21c1
Sequence:CCGGGTTTCCAGTTTGGATCGAAATCTCGAGATTTCGATCCAAACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144934.3-805s21c1
Sequence:CCGGAGTCAGATCTGGAAGGTAAAGCTCGAGCTTTACCTTCCAGATCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144934.3-550s21c1
Sequence:CCGGTGTCAATTGAAGCTTACAAACCTCGAGGTTTGTAAGCTTCAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-305s1c1
Sequence:CCGGCCAAACATAGAACTGGTGTTACTCGAGTAACACCAGTTCTATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-393s1c1
Sequence:CCGGCCCTGAGAATGAAACCAGGTACTCGAGTACCTGGTTTCATTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-741s1c1
Sequence:CCGGAGAAGTAACTATTGCAGACATCTCGAGATGTCTGCAATAGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-559s1c1
Sequence:CCGGCGGGATGAAACTAATGACCAACTCGAGTTGGTCATTAGTTTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144934.2-724s1c1
Sequence:CCGGCCATCTTACTTCATCCAAGAACTCGAGTTCTTGGATGAAGTAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144614
MBD3L2 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 3-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144614.3-370s21c1
Sequence:CCGGGAGCGTCTTAAGTATCCTTGCCTCGAGGCAAGGATACTTAAGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144614.3-240s21c1
Sequence:CCGGACAACCAGGTCAGACGCAGAACTCGAGTTCTGCGTCTGACCTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-105s1c1
Sequence:CCGGCCCTGGGCTTTACAGAAGAAACTCGAGTTTCTTCTGTAAAGCCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-111s1c1
Sequence:CCGGGCTTTACAGAAGAAACGAGAACTCGAGTTCTCGTTTCTTCTGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-216s1c1
Sequence:CCGGGTGACAAGGATCAGGTCTCATCTCGAGATGAGACCTGATCCTTGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-334s1c1
Sequence:CCGGGCAGCCAAGGAGAAGGTTCAACTCGAGTTGAACCTTCTCCTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-360s1c1
Sequence:CCGGCTGCATTTGGAGAGCGTCTTACTCGAGTAAGACGCTCTCCAAATGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144614
MBD3L2 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 3-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144614.3-370s21c1
Sequence:CCGGGAGCGTCTTAAGTATCCTTGCCTCGAGGCAAGGATACTTAAGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144614.3-240s21c1
Sequence:CCGGACAACCAGGTCAGACGCAGAACTCGAGTTCTGCGTCTGACCTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-105s1c1
Sequence:CCGGCCCTGGGCTTTACAGAAGAAACTCGAGTTTCTTCTGTAAAGCCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-111s1c1
Sequence:CCGGGCTTTACAGAAGAAACGAGAACTCGAGTTCTCGTTTCTTCTGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-216s1c1
Sequence:CCGGGTGACAAGGATCAGGTCTCATCTCGAGATGAGACCTGATCCTTGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-334s1c1
Sequence:CCGGGCAGCCAAGGAGAAGGTTCAACTCGAGTTGAACCTTCTCCTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-360s1c1
Sequence:CCGGCTGCATTTGGAGAGCGTCTTACTCGAGTAAGACGCTCTCCAAATGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144614
MBD3L2 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 3-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144614.3-370s21c1
Sequence:CCGGGAGCGTCTTAAGTATCCTTGCCTCGAGGCAAGGATACTTAAGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144614.3-240s21c1
Sequence:CCGGACAACCAGGTCAGACGCAGAACTCGAGTTCTGCGTCTGACCTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-105s1c1
Sequence:CCGGCCCTGGGCTTTACAGAAGAAACTCGAGTTTCTTCTGTAAAGCCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-111s1c1
Sequence:CCGGGCTTTACAGAAGAAACGAGAACTCGAGTTCTCGTTTCTTCTGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-216s1c1
Sequence:CCGGGTGACAAGGATCAGGTCTCATCTCGAGATGAGACCTGATCCTTGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-334s1c1
Sequence:CCGGGCAGCCAAGGAGAAGGTTCAACTCGAGTTGAACCTTCTCCTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144614.2-360s1c1
Sequence:CCGGCTGCATTTGGAGAGCGTCTTACTCGAGTAAGACGCTCTCCAAATGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks