EMAIL THIS PAGE TO A FRIEND

MBD5

methyl-CpG binding domain protein 5

Synonyms: MRD1
UniProtKB ID: Q9P267, A5HMQ4, A7E2B1, Q53SR1, Q9NUV6
Gene ID:
Human(55777) Summary: This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
Mouse(109241) methyl-CpG binding domain protein 5
Rat(311026) methyl-CpG binding domain protein 5
sheep(101121829) methyl-CpG binding domain protein 5
Domestic Rabbit(100358608) methyl-CpG binding domain protein 5
naked mole-rat(101708541) methyl-CpG binding domain protein 5
domestic guinea pig(100731243) methyl-CpG binding domain protein 5
Zebrafish(100009623) methyl-CpG binding domain protein 5
cow(541084) methyl-CpG binding domain protein 5
Horse(100049894) methyl-CpG binding domain protein 5
domestic cat(101098244) methyl-CpG binding domain protein 5
dog(483910) methyl-CpG binding domain protein 5
chicken(424308) methyl-CpG binding domain protein 5
Thale Cress(823811) methyl-CPG-binding domain protein 5
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018328 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126281 MISSION® esiRNA esiRNA human MBD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018328 Rosetta Predictions human pricing
XR_007266 Rosetta Predictions rat pricing
XR_009624 Rosetta Predictions rat pricing
NM_029924 Rosetta Predictions mouse pricing
XM_283719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205351 predicted 1449
2 SASI_Hs01_00205352 predicted 4240
3 SASI_Hs02_00351771 predicted 2393
4 SASI_Hs01_00205353 predicted 1374
5 SASI_Hs01_00205355 predicted 3815
6 SASI_Hs02_00351772 predicted 3160
7 SASI_Hs01_00205356 predicted 3171
8 SASI_Hs01_00205357 predicted 1344
9 SASI_Hs01_00205358 predicted 4156
10 SASI_Hs01_00205359 predicted 1078
11 SASI_Hs01_00205354 predicted 3957
12 SASI_Hs01_00205360 predicted 3946
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00414161 predicted 3467
2 SASI_Rn02_00414162 predicted 2356
3 SASI_Rn02_00414163 predicted 5019
4 SASI_Rn02_00414164 predicted 1239
5 SASI_Rn02_00414165 predicted 425
6 SASI_Rn02_00414166 predicted 3070
7 SASI_Rn02_00414167 predicted 3713
8 SASI_Rn02_00414168 predicted 1218
9 SASI_Rn02_00414169 predicted 3111
10 SASI_Rn02_00414170 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420413 predicted 3471
2 SASI_Rn02_00420414 predicted 2354
3 SASI_Rn02_00420415 predicted 5015
4 SASI_Rn02_00420416 predicted 1243
5 SASI_Rn02_00420417 predicted 422
6 SASI_Rn02_00420418 predicted 3065
7 SASI_Rn02_00420419 predicted 3708
8 SASI_Rn02_00420420 predicted 1219
9 SASI_Rn02_00420421 predicted 3113
10 SASI_Rn02_00420422 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336186 predicted 4140
2 SASI_Mm02_00336187 predicted 3430
3 SASI_Mm02_00336188 predicted 3674
4 SASI_Mm02_00336189 predicted 912
5 SASI_Mm02_00336190 predicted 4969
6 SASI_Mm02_00336191 predicted 1034
7 SASI_Mm02_00336192 predicted 1202
8 SASI_Mm02_00336193 predicted 1673
9 SASI_Mm02_00336194 predicted 1177
10 SASI_Mm02_00336195 predicted 2839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246133 predicted 4100
2 SASI_Mm01_00246134 predicted 3396
3 SASI_Mm01_00246135 predicted 3636
4 SASI_Mm01_00246136 predicted 870
5 SASI_Mm01_00246137 predicted 4929
6 SASI_Mm01_00246138 predicted 997
7 SASI_Mm01_00246139 predicted 1165
8 SASI_Mm01_00246140 predicted 1640
9 SASI_Mm01_00246141 predicted 1142
10 SASI_Mm01_00246142 predicted 2800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018328
VALIDATED
MBD5 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-1263s1c1
Sequence:CCGGCGAGCAATGTTCCACCACAAACTCGAGTTTGTGGTGGAACATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-3194s1c1
Sequence:CCGGGCTGTTAAACAACAATCAGATCTCGAGATCTGATTGTTGTTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018328.3-1660s1c1
Sequence:CCGGCCCAAAGATCACGCTCATCTTCTCGAGAAGATGAGCGTGATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-3321s1c1
Sequence:CCGGGCTTGTCTGTTTCAGAACTTTCTCGAGAAAGTTCTGAAACAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-4462s1c1
Sequence:CCGGGCCAAATCAAAGGACTGACTTCTCGAGAAGTCAGTCCTTTGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018328.3-1660s21c1
Sequence:CCGGCCCAAAGATCACGCTCATCTTCTCGAGAAGATGAGCGTGATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018328.3-1730s21c1
Sequence:CCGGGGCCACTTCTAGTGGTATTAACTCGAGTTAATACCACTAGAAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018328.3-4826s21c1
Sequence:CCGGTGTATCTGTATATAGGTATTGCTCGAGCAATACCTATATACAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018328.3-966s21c1
Sequence:CCGGTCATCAGGTTCCCAGATATATCTCGAGATATATCTGGGAACCTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018328.3-1847s21c1
Sequence:CCGGGGATATCCCTAACCCATTAATCTCGAGATTAATGGGTTAGGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018328
VALIDATED
MBD5 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-1263s1c1
Sequence:CCGGCGAGCAATGTTCCACCACAAACTCGAGTTTGTGGTGGAACATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-3194s1c1
Sequence:CCGGGCTGTTAAACAACAATCAGATCTCGAGATCTGATTGTTGTTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018328.3-1660s1c1
Sequence:CCGGCCCAAAGATCACGCTCATCTTCTCGAGAAGATGAGCGTGATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-3321s1c1
Sequence:CCGGGCTTGTCTGTTTCAGAACTTTCTCGAGAAAGTTCTGAAACAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-4462s1c1
Sequence:CCGGGCCAAATCAAAGGACTGACTTCTCGAGAAGTCAGTCCTTTGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018328.3-1660s21c1
Sequence:CCGGCCCAAAGATCACGCTCATCTTCTCGAGAAGATGAGCGTGATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018328.3-1730s21c1
Sequence:CCGGGGCCACTTCTAGTGGTATTAACTCGAGTTAATACCACTAGAAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018328.3-4826s21c1
Sequence:CCGGTGTATCTGTATATAGGTATTGCTCGAGCAATACCTATATACAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018328.3-966s21c1
Sequence:CCGGTCATCAGGTTCCCAGATATATCTCGAGATATATCTGGGAACCTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018328.3-1847s21c1
Sequence:CCGGGGATATCCCTAACCCATTAATCTCGAGATTAATGGGTTAGGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018328
VALIDATED
MBD5 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-1263s1c1
Sequence:CCGGCGAGCAATGTTCCACCACAAACTCGAGTTTGTGGTGGAACATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-3194s1c1
Sequence:CCGGGCTGTTAAACAACAATCAGATCTCGAGATCTGATTGTTGTTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018328.3-1660s1c1
Sequence:CCGGCCCAAAGATCACGCTCATCTTCTCGAGAAGATGAGCGTGATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-3321s1c1
Sequence:CCGGGCTTGTCTGTTTCAGAACTTTCTCGAGAAAGTTCTGAAACAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018328.3-4462s1c1
Sequence:CCGGGCCAAATCAAAGGACTGACTTCTCGAGAAGTCAGTCCTTTGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018328.3-1660s21c1
Sequence:CCGGCCCAAAGATCACGCTCATCTTCTCGAGAAGATGAGCGTGATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018328.3-1730s21c1
Sequence:CCGGGGCCACTTCTAGTGGTATTAACTCGAGTTAATACCACTAGAAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018328.3-4826s21c1
Sequence:CCGGTGTATCTGTATATAGGTATTGCTCGAGCAATACCTATATACAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018328.3-966s21c1
Sequence:CCGGTCATCAGGTTCCCAGATATATCTCGAGATATATCTGGGAACCTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018328.3-1847s21c1
Sequence:CCGGGGATATCCCTAACCCATTAATCTCGAGATTAATGGGTTAGGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029924
VALIDATED
MBD5 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029924.2-2362s21c1
Sequence:CCGGAGTGAATCAGAACCCTATTATCTCGAGATAATAGGGTTCTGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029924.2-4072s21c1
Sequence:CCGGCCTAAACCAGAATCTATTAAACTCGAGTTTAATAGATTCTGGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029924.2-4797s21c1
Sequence:CCGGCAGGTCTGCTTGGTGATATATCTCGAGATATATCACCAAGCAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029924.2-2815s21c1
Sequence:CCGGGGATATCCCTAACCCATTAATCTCGAGATTAATGGGTTAGGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029924.2-6658s21c1
Sequence:CCGGGTATGAACAAAGCGGTAAATGCTCGAGCATTTACCGCTTTGTTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029924
VALIDATED
MBD5 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029924.2-2362s21c1
Sequence:CCGGAGTGAATCAGAACCCTATTATCTCGAGATAATAGGGTTCTGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029924.2-4072s21c1
Sequence:CCGGCCTAAACCAGAATCTATTAAACTCGAGTTTAATAGATTCTGGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029924.2-4797s21c1
Sequence:CCGGCAGGTCTGCTTGGTGATATATCTCGAGATATATCACCAAGCAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029924.2-2815s21c1
Sequence:CCGGGGATATCCCTAACCCATTAATCTCGAGATTAATGGGTTAGGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029924.2-6658s21c1
Sequence:CCGGGTATGAACAAAGCGGTAAATGCTCGAGCATTTACCGCTTTGTTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029924
VALIDATED
MBD5 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029924.2-2362s21c1
Sequence:CCGGAGTGAATCAGAACCCTATTATCTCGAGATAATAGGGTTCTGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029924.2-4072s21c1
Sequence:CCGGCCTAAACCAGAATCTATTAAACTCGAGTTTAATAGATTCTGGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029924.2-4797s21c1
Sequence:CCGGCAGGTCTGCTTGGTGATATATCTCGAGATATATCACCAAGCAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029924.2-2815s21c1
Sequence:CCGGGGATATCCCTAACCCATTAATCTCGAGATTAATGGGTTAGGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029924.2-6658s21c1
Sequence:CCGGGTATGAACAAAGCGGTAAATGCTCGAGCATTTACCGCTTTGTTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks