EMAIL THIS PAGE TO A FRIEND

MBD6

methyl-CpG binding domain protein 6

UniProtKB ID: Q96DN6, Q8N3M0, Q8NA81, Q96Q00
Gene ID:
Mouse(110962) methyl-CpG binding domain protein 6
Rat(362892) methyl-CpG binding domain protein 6
Zebrafish(561863) methyl-CpG binding domain protein 6
cow(783807) methyl-CpG binding domain protein 6
domestic cat(101094515) methyl-CpG binding domain protein 6
dog(481127) methyl-CpG binding domain protein 6
Thale Cress(836057) methyl-CpG-binding domain-containing protein 6
domestic guinea pig(100721637) methyl-CpG binding domain protein 6
naked mole-rat(101711741) methyl-CpG binding domain protein 6
sheep(101120400) methyl-CpG binding domain protein 6
205 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052897 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074081 MISSION® esiRNA esiRNA human MBD6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052897 Rosetta Predictions human pricing
XM_001055890 Rosetta Predictions rat pricing
XM_343219 Rosetta Predictions rat pricing
NM_033072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034369 predicted 1492
2 SASI_Hs01_00034370 predicted 1004
3 SASI_Hs01_00034371 predicted 3128
4 SASI_Hs01_00034372 predicted 884
5 SASI_Hs01_00034373 predicted 374
6 SASI_Hs01_00034374 predicted 1879
7 SASI_Hs01_00034375 predicted 407
8 SASI_Hs01_00034376 predicted 1689
9 SASI_Hs01_00034377 predicted 1499
10 SASI_Hs01_00034378 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281308 predicted 862
2 SASI_Rn02_00281309 predicted 687
3 SASI_Rn02_00281310 predicted 848
4 SASI_Rn02_00281311 predicted 1749
5 SASI_Rn02_00281312 predicted 445
6 SASI_Rn02_00281313 predicted 1559
7 SASI_Rn02_00281314 predicted 282
8 SASI_Rn02_00281315 predicted 3534
9 SASI_Rn02_00281316 predicted 199
10 SASI_Rn02_00281317 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395503 predicted 869
2 SASI_Rn02_00395504 predicted 686
3 SASI_Rn02_00395505 predicted 847
4 SASI_Rn02_00395506 predicted 451
5 SASI_Rn02_00395507 predicted 3631
6 SASI_Rn02_00395508 predicted 1563
7 SASI_Rn02_00395509 predicted 289
8 SASI_Rn02_00395510 predicted 3535
9 SASI_Rn02_00395511 predicted 200
10 SASI_Rn02_00395512 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025915 predicted 3521
2 SASI_Mm01_00025916 predicted 223
3 SASI_Mm02_00337276 predicted 1934
4 SASI_Mm01_00025917 predicted 3581
5 SASI_Mm01_00025918 predicted 344
6 SASI_Mm01_00025919 predicted 243
7 SASI_Mm01_00025920 predicted 237
8 SASI_Mm01_00025922 predicted 3583
9 SASI_Mm01_00025923 predicted 304
10 SASI_Mm02_00337277 predicted 351
11 SASI_Mm01_00025914 predicted 482
12 SASI_Mm01_00025921 predicted 1812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052897
VALIDATED
MBD6 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-411s21c1
Sequence:CCGGGGTCTGGAGTGTCCACTTAATCTCGAGATTAAGTGGACACTCCAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052897.3-3827s21c1
Sequence:GTACCGGGACTTTCCTCTGGGATATAAACTCGAGTTTATATCCCAGAGGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-2234s21c1
Sequence:CCGGCCCTACCCTCATAGCTTTAAACTCGAGTTTAAAGCTATGAGGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-678s21c1
Sequence:CCGGCCTCCTACAACTCCACTTAATCTCGAGATTAAGTGGAGTTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-1887s21c1
Sequence:CCGGTTGCTCAACCACAGTTTATTTCTCGAGAAATAAACTGTGGTTGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-1332s1c1
Sequence:CCGGCCTACTGTATTTCGATTGCTACTCGAGTAGCAATCGAAATACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_052897.3-2912s1c1
Sequence:CCGGTGGTGGCTTCAATGGACAAATCTCGAGATTTGTCCATTGAAGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-1895s1c1
Sequence:CCGGCCACAGTTTATTTGGTGTGCTCTCGAGAGCACACCAAATAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-678s1c1
Sequence:CCGGCCTCCTACAACTCCACTTAATCTCGAGATTAAGTGGAGTTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-2234s1c1
Sequence:CCGGCCCTACCCTCATAGCTTTAAACTCGAGTTTAAAGCTATGAGGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052897
VALIDATED
MBD6 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-411s21c1
Sequence:CCGGGGTCTGGAGTGTCCACTTAATCTCGAGATTAAGTGGACACTCCAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052897.3-3827s21c1
Sequence:GTACCGGGACTTTCCTCTGGGATATAAACTCGAGTTTATATCCCAGAGGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-2234s21c1
Sequence:CCGGCCCTACCCTCATAGCTTTAAACTCGAGTTTAAAGCTATGAGGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-678s21c1
Sequence:CCGGCCTCCTACAACTCCACTTAATCTCGAGATTAAGTGGAGTTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-1887s21c1
Sequence:CCGGTTGCTCAACCACAGTTTATTTCTCGAGAAATAAACTGTGGTTGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-1332s1c1
Sequence:CCGGCCTACTGTATTTCGATTGCTACTCGAGTAGCAATCGAAATACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_052897.3-2912s1c1
Sequence:CCGGTGGTGGCTTCAATGGACAAATCTCGAGATTTGTCCATTGAAGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-1895s1c1
Sequence:CCGGCCACAGTTTATTTGGTGTGCTCTCGAGAGCACACCAAATAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-678s1c1
Sequence:CCGGCCTCCTACAACTCCACTTAATCTCGAGATTAAGTGGAGTTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-2234s1c1
Sequence:CCGGCCCTACCCTCATAGCTTTAAACTCGAGTTTAAAGCTATGAGGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052897
VALIDATED
MBD6 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-411s21c1
Sequence:CCGGGGTCTGGAGTGTCCACTTAATCTCGAGATTAAGTGGACACTCCAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052897.3-3827s21c1
Sequence:GTACCGGGACTTTCCTCTGGGATATAAACTCGAGTTTATATCCCAGAGGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-2234s21c1
Sequence:CCGGCCCTACCCTCATAGCTTTAAACTCGAGTTTAAAGCTATGAGGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-678s21c1
Sequence:CCGGCCTCCTACAACTCCACTTAATCTCGAGATTAAGTGGAGTTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052897.3-1887s21c1
Sequence:CCGGTTGCTCAACCACAGTTTATTTCTCGAGAAATAAACTGTGGTTGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-1332s1c1
Sequence:CCGGCCTACTGTATTTCGATTGCTACTCGAGTAGCAATCGAAATACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_052897.3-2912s1c1
Sequence:CCGGTGGTGGCTTCAATGGACAAATCTCGAGATTTGTCCATTGAAGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-1895s1c1
Sequence:CCGGCCACAGTTTATTTGGTGTGCTCTCGAGAGCACACCAAATAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-678s1c1
Sequence:CCGGCCTCCTACAACTCCACTTAATCTCGAGATTAAGTGGAGTTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052897.3-2234s1c1
Sequence:CCGGCCCTACCCTCATAGCTTTAAACTCGAGTTTAAAGCTATGAGGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033072
VALIDATED
MBD6 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033072.2-1818s1c1
Sequence:CCGGCATTCCTTAGCCACAGTTTATCTCGAGATAAACTGTGGCTAAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033072.1-834s1c1
Sequence:CCGGGACCGAAACACATAGCCTCATCTCGAGATGAGGCTATGTGTTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033072.1-729s1c1
Sequence:CCGGGTACAGAGCAATAAGCATCATCTCGAGATGATGCTTATTGCTCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033072.1-720s1c1
Sequence:CCGGCAGTGAAAGGTACAGAGCAATCTCGAGATTGCTCTGTACCTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033072.1-101s1c1
Sequence:CCGGCATTCTAAGGACCTTAAGGTGCTCGAGCACCTTAAGGTCCTTAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033072.1-849s1c1
Sequence:CCGGCCTCATTTCAAAGCGTAGCCACTCGAGTGGCTACGCTTTGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033072.1-836s1c1
Sequence:CCGGCCGAAACACATAGCCTCATTTCTCGAGAAATGAGGCTATGTGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033072.1-672s1c1
Sequence:CCGGGCTCAGTTTACAAACCTGTGACTCGAGTCACAGGTTTGTAAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033072
VALIDATED
MBD6 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033072.2-1818s1c1
Sequence:CCGGCATTCCTTAGCCACAGTTTATCTCGAGATAAACTGTGGCTAAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033072.1-834s1c1
Sequence:CCGGGACCGAAACACATAGCCTCATCTCGAGATGAGGCTATGTGTTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033072.1-729s1c1
Sequence:CCGGGTACAGAGCAATAAGCATCATCTCGAGATGATGCTTATTGCTCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033072.1-720s1c1
Sequence:CCGGCAGTGAAAGGTACAGAGCAATCTCGAGATTGCTCTGTACCTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033072.1-101s1c1
Sequence:CCGGCATTCTAAGGACCTTAAGGTGCTCGAGCACCTTAAGGTCCTTAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033072.1-849s1c1
Sequence:CCGGCCTCATTTCAAAGCGTAGCCACTCGAGTGGCTACGCTTTGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033072.1-836s1c1
Sequence:CCGGCCGAAACACATAGCCTCATTTCTCGAGAAATGAGGCTATGTGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033072.1-672s1c1
Sequence:CCGGGCTCAGTTTACAAACCTGTGACTCGAGTCACAGGTTTGTAAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033072
VALIDATED
MBD6 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033072.2-1818s1c1
Sequence:CCGGCATTCCTTAGCCACAGTTTATCTCGAGATAAACTGTGGCTAAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033072.1-834s1c1
Sequence:CCGGGACCGAAACACATAGCCTCATCTCGAGATGAGGCTATGTGTTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033072.1-729s1c1
Sequence:CCGGGTACAGAGCAATAAGCATCATCTCGAGATGATGCTTATTGCTCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033072.1-720s1c1
Sequence:CCGGCAGTGAAAGGTACAGAGCAATCTCGAGATTGCTCTGTACCTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033072.1-101s1c1
Sequence:CCGGCATTCTAAGGACCTTAAGGTGCTCGAGCACCTTAAGGTCCTTAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033072.1-849s1c1
Sequence:CCGGCCTCATTTCAAAGCGTAGCCACTCGAGTGGCTACGCTTTGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033072.1-836s1c1
Sequence:CCGGCCGAAACACATAGCCTCATTTCTCGAGAAATGAGGCTATGTGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033072.1-672s1c1
Sequence:CCGGGCTCAGTTTACAAACCTGTGACTCGAGTCACAGGTTTGTAAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks