EMAIL THIS PAGE TO A FRIEND

MBNL2

muscleblind-like splicing regulator 2

Synonyms: MBLL MBLL39 PRO2032
UniProtKB ID: Q5VZF2, Q3SXY5, Q58F19, Q8NEV3, Q8TD82
Gene ID:
Human(10150) Summary: This gene is a member of the muscleblind protein family which was initially described in Drosophila melanogaster. This gene encodes a C3H-type zinc finger protein that modulates alternative splicing of pre-mRNAs. Muscleblind proteins bind specifically to expanded dsCUG RNA but not to normal size CUG repeats and may thereby play a role in the pathophysiology of myotonic dystrophy. Several alternatively spliced transcript variants have been described but the full-length natures of only some have been determined. [provided by RefSeq, Mar 2012]
Mouse(105559) muscleblind-like 2
Rat(680445) muscleblind-like splicing regulator 2
Zebrafish(560384) muscleblind-like 2 (Drosophila)
cow(527679) muscleblind-like 2 (Drosophila)
domestic cat(101097201) muscleblind-like splicing regulator 2
dog(612815) muscleblind-like splicing regulator 2
chicken(418784) muscleblind-like 2 (Drosophila)
naked mole-rat(101712983) muscleblind-like splicing regulator 2
domestic guinea pig(100715269) muscleblind-like splicing regulator 2
sheep(101109458) muscleblind-like splicing regulator 2
323 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005757 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207304 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144778 Rosetta Predictions human pricing
NM_207304 Rosetta Predictions human pricing
NM_001111064 Rosetta Predictions rat pricing
NM_175341 Rosetta Predictions mouse pricing
NM_207515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240756 predicted 1269
2 SASI_Hs01_00240757 predicted 2116
3 SASI_Hs01_00240758 predicted 2206
4 SASI_Hs01_00240759 predicted 896
5 SASI_Hs01_00240760 predicted 1447
6 SASI_Hs01_00240762 predicted 2127
7 SASI_Hs02_00364723 predicted 1193
8 SASI_Hs02_00364724 predicted 854
9 SASI_Hs01_00240765 predicted 1014
10 SASI_Hs02_00364725 predicted 1423
11 SASI_Hs01_00240761 predicted 2173
12 SASI_Hs01_00240763 predicted 1462
13 SASI_Hs01_00240764 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082818 predicted 2153
2 SASI_Hs01_00082819 predicted 1978
3 SASI_Hs01_00082820 predicted 2101
4 SASI_Hs01_00082821 predicted 1441
5 SASI_Hs01_00082822 predicted 2001
6 SASI_Hs01_00082823 predicted 1464
7 SASI_Hs01_00082824 predicted 854
8 SASI_Hs01_00082825 predicted 2160
9 SASI_Hs01_00082826 predicted 2033
10 SASI_Hs01_00082827 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251462 predicted 1890
2 SASI_Rn02_00251463 predicted 1853
3 SASI_Rn02_00251464 predicted 1305
4 SASI_Rn02_00251465 predicted 1808
5 SASI_Rn02_00251466 predicted 1050
6 SASI_Rn02_00251467 predicted 706
7 SASI_Rn02_00251468 predicted 857
8 SASI_Rn02_00251469 predicted 1046
9 SASI_Rn02_00251470 predicted 1289
10 SASI_Rn02_00251471 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085661 predicted 1832
2 SASI_Mm01_00085662 predicted 1890
3 SASI_Mm01_00085663 predicted 1058
4 SASI_Mm01_00085664 predicted 1057
5 SASI_Mm02_00346141 predicted 931
6 SASI_Mm01_00085665 predicted 1806
7 SASI_Mm01_00085666 predicted 1893
8 SASI_Mm01_00085667 predicted 863
9 SASI_Mm01_00085668 predicted 1060
10 SASI_Mm02_00346142 predicted 930
11 SASI_Mm01_00085669 predicted 948
12 SASI_Mm01_00085670 predicted 1877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108992 predicted 1780
2 SASI_Mm01_00108993 predicted 1836
3 SASI_Mm01_00108994 predicted 1052
4 SASI_Mm01_00108995 predicted 1058
5 SASI_Mm02_00352055 predicted 930
6 SASI_Mm01_00108996 predicted 1755
7 SASI_Mm01_00108997 predicted 1839
8 SASI_Mm01_00108998 predicted 863
9 SASI_Mm01_00108999 predicted 1061
10 SASI_Mm02_00352056 predicted 926
11 SASI_Mm01_00109000 predicted 952
12 SASI_Mm01_00109001 predicted 1814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005757
VALIDATED
MBNL2 MISSION shRNA Bacterial Glycerol Stock
muscleblind-like splicing regulator 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_005757.4-1193s1c1
Sequence:CCGGCGGCTATTAGCTTTGCTCCTTCTCGAGAAGGAGCAAAGCTAATAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005757.4-1452s1c1
Sequence:CCGGCAACACCGTAACCGTTTGTATCTCGAGATACAAACGGTTACGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_005757.4-1110s1c1
Sequence:CCGGCCAGCAGATGCAATTTATGTTCTCGAGAACATAAATTGCATCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005757.4-902s1c1
Sequence:CCGGGCTCTGATGAAGAATGCAAATCTCGAGATTTGCATTCTTCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005757.4-1458s1c1
Sequence:CCGGCGTAACCGTTTGTATGGATTACTCGAGTAATCCATACAAACGGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005757
VALIDATED
MBNL2 MISSION shRNA shRNA Plasmid DNA
muscleblind-like splicing regulator 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_005757.4-1193s1c1
Sequence:CCGGCGGCTATTAGCTTTGCTCCTTCTCGAGAAGGAGCAAAGCTAATAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005757.4-1452s1c1
Sequence:CCGGCAACACCGTAACCGTTTGTATCTCGAGATACAAACGGTTACGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_005757.4-1110s1c1
Sequence:CCGGCCAGCAGATGCAATTTATGTTCTCGAGAACATAAATTGCATCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005757.4-902s1c1
Sequence:CCGGGCTCTGATGAAGAATGCAAATCTCGAGATTTGCATTCTTCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005757.4-1458s1c1
Sequence:CCGGCGTAACCGTTTGTATGGATTACTCGAGTAATCCATACAAACGGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005757
VALIDATED
MBNL2 MISSION shRNA Lentiviral Transduction Particles
muscleblind-like splicing regulator 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_005757.4-1193s1c1
Sequence:CCGGCGGCTATTAGCTTTGCTCCTTCTCGAGAAGGAGCAAAGCTAATAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005757.4-1452s1c1
Sequence:CCGGCAACACCGTAACCGTTTGTATCTCGAGATACAAACGGTTACGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_005757.4-1110s1c1
Sequence:CCGGCCAGCAGATGCAATTTATGTTCTCGAGAACATAAATTGCATCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005757.4-902s1c1
Sequence:CCGGGCTCTGATGAAGAATGCAAATCTCGAGATTTGCATTCTTCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005757.4-1458s1c1
Sequence:CCGGCGTAACCGTTTGTATGGATTACTCGAGTAATCCATACAAACGGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207515
VALIDATED
MBNL2 MISSION shRNA Bacterial Glycerol Stock
muscleblind-like splicing regulator 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207515.1-3907s1c1
Sequence:CCGGGCCAATATAGATGACTGTATTCTCGAGAATACAGTCATCTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207515.1-1547s1c1
Sequence:CCGGCAAAGAGACAAGCACTTGAAACTCGAGTTTCAAGTGCTTGTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207515.1-1088s1c1
Sequence:CCGGCGGCTATTAGCTTTGCTCCTTCTCGAGAAGGAGCAAAGCTAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207515.1-1353s1c1
Sequence:CCGGCGTAACCGTTTGTATGGATTACTCGAGTAATCCATACAAACGGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207515.1-1358s1c1
Sequence:CCGGCCGTTTGTATGGATTACATAACTCGAGTTATGTAATCCATACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207515
VALIDATED
MBNL2 MISSION shRNA shRNA Plasmid DNA
muscleblind-like splicing regulator 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207515.1-3907s1c1
Sequence:CCGGGCCAATATAGATGACTGTATTCTCGAGAATACAGTCATCTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207515.1-1547s1c1
Sequence:CCGGCAAAGAGACAAGCACTTGAAACTCGAGTTTCAAGTGCTTGTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207515.1-1088s1c1
Sequence:CCGGCGGCTATTAGCTTTGCTCCTTCTCGAGAAGGAGCAAAGCTAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207515.1-1353s1c1
Sequence:CCGGCGTAACCGTTTGTATGGATTACTCGAGTAATCCATACAAACGGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207515.1-1358s1c1
Sequence:CCGGCCGTTTGTATGGATTACATAACTCGAGTTATGTAATCCATACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207515
VALIDATED
MBNL2 MISSION shRNA Lentiviral Transduction Particles
muscleblind-like splicing regulator 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207515.1-3907s1c1
Sequence:CCGGGCCAATATAGATGACTGTATTCTCGAGAATACAGTCATCTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207515.1-1547s1c1
Sequence:CCGGCAAAGAGACAAGCACTTGAAACTCGAGTTTCAAGTGCTTGTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207515.1-1088s1c1
Sequence:CCGGCGGCTATTAGCTTTGCTCCTTCTCGAGAAGGAGCAAAGCTAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207515.1-1353s1c1
Sequence:CCGGCGTAACCGTTTGTATGGATTACTCGAGTAATCCATACAAACGGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207515.1-1358s1c1
Sequence:CCGGCCGTTTGTATGGATTACATAACTCGAGTTATGTAATCCATACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207304
VALIDATED
MBNL2 MISSION shRNA Bacterial Glycerol Stock
muscleblind-like splicing regulator 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000353711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1110s21c1
Sequence:CCGGCCAGCAGATGCAATTTATGTTCTCGAGAACATAAATTGCATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1193s21c1
Sequence:CCGGCGGCTATTAGCTTTGCTCCTTCTCGAGAAGGAGCAAAGCTAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1944s21c1
Sequence:CCGGGCTAGTGCTGCTATCTCATATCTCGAGATATGAGATAGCAGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1452s21c1
Sequence:CCGGCAACACCGTAACCGTTTGTATCTCGAGATACAAACGGTTACGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207304
VALIDATED
MBNL2 MISSION shRNA shRNA Plasmid DNA
muscleblind-like splicing regulator 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000353711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1110s21c1
Sequence:CCGGCCAGCAGATGCAATTTATGTTCTCGAGAACATAAATTGCATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1193s21c1
Sequence:CCGGCGGCTATTAGCTTTGCTCCTTCTCGAGAAGGAGCAAAGCTAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1944s21c1
Sequence:CCGGGCTAGTGCTGCTATCTCATATCTCGAGATATGAGATAGCAGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1452s21c1
Sequence:CCGGCAACACCGTAACCGTTTGTATCTCGAGATACAAACGGTTACGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207304
VALIDATED
MBNL2 MISSION shRNA Lentiviral Transduction Particles
muscleblind-like splicing regulator 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000353711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1110s21c1
Sequence:CCGGCCAGCAGATGCAATTTATGTTCTCGAGAACATAAATTGCATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1193s21c1
Sequence:CCGGCGGCTATTAGCTTTGCTCCTTCTCGAGAAGGAGCAAAGCTAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1944s21c1
Sequence:CCGGGCTAGTGCTGCTATCTCATATCTCGAGATATGAGATAGCAGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_207304.1-1452s21c1
Sequence:CCGGCAACACCGTAACCGTTTGTATCTCGAGATACAAACGGTTACGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks