EMAIL THIS PAGE TO A FRIEND

MC4R

melanocortin 4 receptor

UniProtKB ID: P32245, B2RAC3, Q16317, Q3MIJ6
Gene ID:
Human(4160) Summary: The protein encoded by this gene is a membrane-bound receptor and member of the melanocortin receptor family. The encoded protein interacts with adrenocorticotropic and MSH hormones and is mediated by G proteins. This is an intronless gene. Defects in this gene are a cause of autosomal dominant obesity. [provided by RefSeq, Jan 2010]
Mouse(17202) melanocortin 4 receptor
Rat(25635) melanocortin 4 receptor
Zebrafish(286833) melanocortin 4 receptor
domestic cat(101081334) melanocortin 4 receptor
cow(281300) melanocortin 4 receptor
dog(483961) melanocortin 4 receptor
chicken(428485) melanocortin 4 receptor
domestic guinea pig(100379598) melanocortin 4 receptor
Domestic Rabbit(100355375) melanocortin 4 receptor
Goat(100861239) melanocortin 4 receptor
sheep(100147707) melanocortin 4 receptor
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
M8693 Melanotan II acetate salt ≥95% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005912 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006521 MISSION® esiRNA esiRNA targeting human MC4R (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005912 Rosetta Predictions human pricing
NM_013099 Rosetta Predictions rat pricing
NM_016977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196297 predicted 788
2 SASI_Hs01_00196299 predicted 1040
3 SASI_Hs01_00196300 predicted 681
4 SASI_Hs02_00340530 predicted 611
5 SASI_Hs02_00340531 predicted 697
6 SASI_Hs01_00196296 predicted 725
7 SASI_Hs02_00340532 predicted 918
8 SASI_Hs01_00196302 predicted 1148
9 SASI_Hs02_00340533 predicted 733
10 SASI_Hs01_00196304 predicted 839
11 SASI_Hs01_00196298 predicted 439
12 SASI_Hs01_00196301 predicted 354
13 SASI_Hs01_00196303 predicted 488
14 SASI_Hs01_00196305 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115792 predicted 929
2 SASI_Rn01_00115793 predicted 1015
3 SASI_Rn01_00115794 predicted 1380
4 SASI_Rn01_00115795 predicted 689
5 SASI_Rn01_00115796 predicted 1129
6 SASI_Rn01_00115797 predicted 1429
7 SASI_Rn01_00115798 predicted 1383
8 SASI_Rn01_00115799 predicted 1210
9 SASI_Rn01_00115800 predicted 1130
10 SASI_Rn01_00115801 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128927 predicted 869
2 SASI_Mm01_00128928 predicted 592
3 SASI_Mm01_00128929 predicted 922
4 SASI_Mm01_00128930 predicted 689
5 SASI_Mm01_00128931 predicted 1341
6 SASI_Mm01_00128932 predicted 1162
7 SASI_Mm01_00128933 predicted 742
8 SASI_Mm01_00128934 predicted 1212
9 SASI_Mm01_00128935 predicted 706
10 SASI_Mm01_00128936 predicted 1321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005912
MC4R MISSION shRNA Bacterial Glycerol Stock
melanocortin 4 receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-910s21c1
Sequence:CCGGAGCGGGTTGGGATCATCATAACTCGAGTTATGATGATCCCAACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-721s21c1
Sequence:CCGGCCATTGTCATCACCCTATTAACTCGAGTTAATAGGGTGATGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-847s21c1
Sequence:CCGGTTGCAGTGGACAGGTACTTTACTCGAGTAAAGTACCTGTCCACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-1196s21c1
Sequence:CCGGCCCATTCTTCCTCCACTTAATCTCGAGATTAAGTGGAGGAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-314s1c1
Sequence:CCGGCCCTATTAAACAGTACAGATACTCGAGTATCTGTACTGTTTAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-832s1c1
Sequence:CCGGGTGTGCTTCATGTCTCACTTTCTCGAGAAAGTGAGACATGAAGCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-460s1c1
Sequence:CCGGGCTCTCCAGTACCATAACATTCTCGAGAATGTTATGGTACTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-281s1c1
Sequence:CCGGGCGTTTCAAATGGATCAGAAACTCGAGTTTCTGATCCATTTGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-340s1c1
Sequence:CCGGGCACAGAGTTTCACAGTGAATCTCGAGATTCACTGTGAAACTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005912
MC4R MISSION shRNA shRNA Plasmid DNA
melanocortin 4 receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-910s21c1
Sequence:CCGGAGCGGGTTGGGATCATCATAACTCGAGTTATGATGATCCCAACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-721s21c1
Sequence:CCGGCCATTGTCATCACCCTATTAACTCGAGTTAATAGGGTGATGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-847s21c1
Sequence:CCGGTTGCAGTGGACAGGTACTTTACTCGAGTAAAGTACCTGTCCACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-1196s21c1
Sequence:CCGGCCCATTCTTCCTCCACTTAATCTCGAGATTAAGTGGAGGAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-314s1c1
Sequence:CCGGCCCTATTAAACAGTACAGATACTCGAGTATCTGTACTGTTTAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-832s1c1
Sequence:CCGGGTGTGCTTCATGTCTCACTTTCTCGAGAAAGTGAGACATGAAGCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-460s1c1
Sequence:CCGGGCTCTCCAGTACCATAACATTCTCGAGAATGTTATGGTACTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-281s1c1
Sequence:CCGGGCGTTTCAAATGGATCAGAAACTCGAGTTTCTGATCCATTTGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-340s1c1
Sequence:CCGGGCACAGAGTTTCACAGTGAATCTCGAGATTCACTGTGAAACTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005912
MC4R MISSION shRNA Lentiviral Transduction Particles
melanocortin 4 receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-910s21c1
Sequence:CCGGAGCGGGTTGGGATCATCATAACTCGAGTTATGATGATCCCAACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-721s21c1
Sequence:CCGGCCATTGTCATCACCCTATTAACTCGAGTTAATAGGGTGATGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-847s21c1
Sequence:CCGGTTGCAGTGGACAGGTACTTTACTCGAGTAAAGTACCTGTCCACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005912.2-1196s21c1
Sequence:CCGGCCCATTCTTCCTCCACTTAATCTCGAGATTAAGTGGAGGAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-314s1c1
Sequence:CCGGCCCTATTAAACAGTACAGATACTCGAGTATCTGTACTGTTTAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-832s1c1
Sequence:CCGGGTGTGCTTCATGTCTCACTTTCTCGAGAAAGTGAGACATGAAGCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-460s1c1
Sequence:CCGGGCTCTCCAGTACCATAACATTCTCGAGAATGTTATGGTACTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-281s1c1
Sequence:CCGGGCGTTTCAAATGGATCAGAAACTCGAGTTTCTGATCCATTTGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005912.1-340s1c1
Sequence:CCGGGCACAGAGTTTCACAGTGAATCTCGAGATTCACTGTGAAACTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016977
MC4R MISSION shRNA Bacterial Glycerol Stock
melanocortin 4 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-113s1c1
Sequence:CCGGGAGGATGCTATGAGCAACTTTCTCGAGAAAGTTGCTCATAGCATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-498s1c1
Sequence:CCGGCGGGATCATCATAAGTTGTATCTCGAGATACAACTTATGATGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-831s1c1
Sequence:CCGGCGTGTGCTTCATGTCTCATTTCTCGAGAAATGAGACATGAAGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-302s1c1
Sequence:CCGGCCATCGTCATTACCCTGTTAACTCGAGTTAACAGGGTAATGACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-314s1c1
Sequence:CCGGCCCTGTTAAACAGTACGGATACTCGAGTATCCGTACTGTTTAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016977
MC4R MISSION shRNA shRNA Plasmid DNA
melanocortin 4 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-113s1c1
Sequence:CCGGGAGGATGCTATGAGCAACTTTCTCGAGAAAGTTGCTCATAGCATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-498s1c1
Sequence:CCGGCGGGATCATCATAAGTTGTATCTCGAGATACAACTTATGATGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-831s1c1
Sequence:CCGGCGTGTGCTTCATGTCTCATTTCTCGAGAAATGAGACATGAAGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-302s1c1
Sequence:CCGGCCATCGTCATTACCCTGTTAACTCGAGTTAACAGGGTAATGACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-314s1c1
Sequence:CCGGCCCTGTTAAACAGTACGGATACTCGAGTATCCGTACTGTTTAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016977
MC4R MISSION shRNA Lentiviral Transduction Particles
melanocortin 4 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-113s1c1
Sequence:CCGGGAGGATGCTATGAGCAACTTTCTCGAGAAAGTTGCTCATAGCATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-498s1c1
Sequence:CCGGCGGGATCATCATAAGTTGTATCTCGAGATACAACTTATGATGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-831s1c1
Sequence:CCGGCGTGTGCTTCATGTCTCATTTCTCGAGAAATGAGACATGAAGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-302s1c1
Sequence:CCGGCCATCGTCATTACCCTGTTAACTCGAGTTAACAGGGTAATGACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016977.1-314s1c1
Sequence:CCGGCCCTGTTAAACAGTACGGATACTCGAGTATCCGTACTGTTTAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks