EMAIL THIS PAGE TO A FRIEND

MCF2L

MCF.2 cell line derived transforming sequence-like

Synonyms: ARHGEF14 DBS OST
Gene ID:
Mouse(17207) mcf.2 transforming sequence-like
Rat(117020) MCF.2 cell line derived transforming sequence-like
Zebrafish(569231) MCF.2 cell line derived transforming sequence-like
domestic cat(101090322) MCF.2 cell line derived transforming sequence-like
Horse(100067048) MCF.2 cell line derived transforming sequence-like
dog(485555) MCF.2 cell line derived transforming sequence-like
chicken(418748) MCF.2 cell line derived transforming sequence-like
cow(505595) MCF.2 cell line derived transforming sequence-like
sheep(101118115) MCF.2 cell line derived transforming sequence-like
naked mole-rat(101708482) MCF.2 cell line derived transforming sequence-like
domestic guinea pig(100727435) MCF.2 cell line derived transforming sequence-like
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024979 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112732 Rosetta Predictions human pricing
NM_024979 Rosetta Predictions human pricing
NM_053951 Rosetta Predictions rat pricing
NM_178076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325495 predicted 702
2 SASI_Hs02_00325496 predicted 2763
3 SASI_Hs02_00325497 predicted 1642
4 SASI_Hs02_00325498 predicted 483
5 SASI_Hs02_00325499 predicted 652
6 SASI_Hs02_00325500 predicted 3036
7 SASI_Hs02_00325501 predicted 2107
8 SASI_Hs02_00325502 predicted 949
9 SASI_Hs02_00325503 predicted 2085
10 SASI_Hs02_00325504 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050602 predicted 854
2 SASI_Hs01_00050603 predicted 2909
3 SASI_Hs01_00050605 predicted 1793
4 SASI_Hs01_00050607 predicted 633
5 SASI_Hs02_00357637 predicted 800
6 SASI_Hs01_00050608 predicted 3175
7 SASI_Hs01_00050609 predicted 2253
8 SASI_Hs01_00050611 predicted 1093
9 SASI_Hs02_00357638 predicted 2239
10 SASI_Hs02_00357639 predicted 2376
11 SASI_Hs01_00050604 predicted 290
12 SASI_Hs01_00050606 predicted 232
13 SASI_Hs01_00050610 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030464 predicted 1184
2 SASI_Rn01_00030466 predicted 1992
3 SASI_Rn02_00266910 predicted 473
4 SASI_Rn01_00030468 predicted 2658
5 SASI_Rn02_00266911 predicted 2982
6 SASI_Rn02_00266912 predicted 3342
7 SASI_Rn02_00266913 predicted 748
8 SASI_Rn02_00266914 predicted 473
9 SASI_Rn01_00030470 predicted 1200
10 SASI_Rn01_00030471 predicted 540
11 SASI_Rn01_00030465 predicted 2688
12 SASI_Rn01_00030467 predicted 2731
13 SASI_Rn01_00030469 predicted 972
14 SASI_Rn01_00030472 predicted 2057
15 SASI_Rn01_00030473 predicted 2686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081260 predicted 2589
2 SASI_Mm01_00081261 predicted 464
3 SASI_Mm01_00081262 predicted 2662
4 SASI_Mm01_00081263 predicted 752
5 SASI_Mm01_00081264 predicted 764
6 SASI_Mm01_00081265 predicted 2175
7 SASI_Mm01_00081266 predicted 1972
8 SASI_Mm01_00081267 predicted 1465
9 SASI_Mm01_00081268 predicted 3098
10 SASI_Mm01_00081269 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024979
MCF2L MISSION shRNA Bacterial Glycerol Stock
MCF.2 cell line derived transforming sequence-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-1546s1c1
Sequence:CCGGCCTCCAGGAAATCGAGAAGTTCTCGAGAACTTCTCGATTTCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-658s1c1
Sequence:CCGGCGTACCAGACTTACACGGTTACTCGAGTAACCGTGTAAGTCTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-2081s1c1
Sequence:CCGGCTTCACAACAAGAAGGATGTTCTCGAGAACATCCTTCTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-2867s1c1
Sequence:CCGGTGGGTGAATGAAATTCGGAAACTCGAGTTTCCGAATTTCATTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-592s1c1
Sequence:CCGGCGACATCGCTTTCAAATTCAACTCGAGTTGAATTTGAAAGCGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024979
MCF2L MISSION shRNA shRNA Plasmid DNA
MCF.2 cell line derived transforming sequence-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-1546s1c1
Sequence:CCGGCCTCCAGGAAATCGAGAAGTTCTCGAGAACTTCTCGATTTCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-658s1c1
Sequence:CCGGCGTACCAGACTTACACGGTTACTCGAGTAACCGTGTAAGTCTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-2081s1c1
Sequence:CCGGCTTCACAACAAGAAGGATGTTCTCGAGAACATCCTTCTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-2867s1c1
Sequence:CCGGTGGGTGAATGAAATTCGGAAACTCGAGTTTCCGAATTTCATTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-592s1c1
Sequence:CCGGCGACATCGCTTTCAAATTCAACTCGAGTTGAATTTGAAAGCGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024979
MCF2L MISSION shRNA Lentiviral Transduction Particles
MCF.2 cell line derived transforming sequence-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-1546s1c1
Sequence:CCGGCCTCCAGGAAATCGAGAAGTTCTCGAGAACTTCTCGATTTCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-658s1c1
Sequence:CCGGCGTACCAGACTTACACGGTTACTCGAGTAACCGTGTAAGTCTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-2081s1c1
Sequence:CCGGCTTCACAACAAGAAGGATGTTCTCGAGAACATCCTTCTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-2867s1c1
Sequence:CCGGTGGGTGAATGAAATTCGGAAACTCGAGTTTCCGAATTTCATTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024979.2-592s1c1
Sequence:CCGGCGACATCGCTTTCAAATTCAACTCGAGTTGAATTTGAAAGCGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178076
MCF2L MISSION shRNA Bacterial Glycerol Stock
MCF.2 cell line derived transforming sequence-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178076.2-4346s1c1
Sequence:CCGGGCACGTTGTTTATACAACTAACTCGAGTTAGTTGTATAAACAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-1974s1c1
Sequence:CCGGGTTTGGAAACATGGAGGAAATCTCGAGATTTCCTCCATGTTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-1179s1c1
Sequence:CCGGGCTGATTGAGAACAGGCACTACTCGAGTAGTGCCTGTTCTCAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-529s1c1
Sequence:CCGGCCAGAACTACACGGCTACATTCTCGAGAATGTAGCCGTGTAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-79s1c1
Sequence:CCGGGCGGTTTCCAAGAACACTGATCTCGAGATCAGTGTTCTTGGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178076
MCF2L MISSION shRNA shRNA Plasmid DNA
MCF.2 cell line derived transforming sequence-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178076.2-4346s1c1
Sequence:CCGGGCACGTTGTTTATACAACTAACTCGAGTTAGTTGTATAAACAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-1974s1c1
Sequence:CCGGGTTTGGAAACATGGAGGAAATCTCGAGATTTCCTCCATGTTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-1179s1c1
Sequence:CCGGGCTGATTGAGAACAGGCACTACTCGAGTAGTGCCTGTTCTCAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-529s1c1
Sequence:CCGGCCAGAACTACACGGCTACATTCTCGAGAATGTAGCCGTGTAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-79s1c1
Sequence:CCGGGCGGTTTCCAAGAACACTGATCTCGAGATCAGTGTTCTTGGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178076
MCF2L MISSION shRNA Lentiviral Transduction Particles
MCF.2 cell line derived transforming sequence-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178076.2-4346s1c1
Sequence:CCGGGCACGTTGTTTATACAACTAACTCGAGTTAGTTGTATAAACAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-1974s1c1
Sequence:CCGGGTTTGGAAACATGGAGGAAATCTCGAGATTTCCTCCATGTTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-1179s1c1
Sequence:CCGGGCTGATTGAGAACAGGCACTACTCGAGTAGTGCCTGTTCTCAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-529s1c1
Sequence:CCGGCCAGAACTACACGGCTACATTCTCGAGAATGTAGCCGTGTAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178076.2-79s1c1
Sequence:CCGGGCGGTTTCCAAGAACACTGATCTCGAGATCAGTGTTCTTGGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks