EMAIL THIS PAGE TO A FRIEND

MCM3

minichromosome maintenance complex component 3

Synonyms: HCC5 P1-MCM3 P1.h RLFB
UniProtKB ID: P25205, Q92660, Q9BTR3, Q9NUE7
Gene ID:
Human(4172) Summary: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(17215) minichromosome maintenance deficient 3 (S. cerevisiae)
Rat(316273) minichromosome maintenance complex component 3
Zebrafish(192323) MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)
cow(281302) minichromosome maintenance complex component 3
Horse(100069108) minichromosome maintenance complex component 3
domestic cat(101083515) minichromosome maintenance complex component 3
dog(481839) minichromosome maintenance complex component 3
Thale Cress(834670) DNA replication licensing factor MCM3-like protein
Zebrafish(100536986) minichromosome maintenance complex component 3
fruit fly(31449) Minichromosome maintenance 3
chicken(422043) minichromosome maintenance complex component 3
sheep(101104435) minichromosome maintenance complex component 3
naked mole-rat(101719015) minichromosome maintenance complex component 3
Domestic Rabbit(100339825) minichromosome maintenance complex component 3
domestic guinea pig(100729563) minichromosome maintenance complex component 3
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36644 Anti-MCM3 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, rabbit, bovine, mouse, rat
western blot pricing
AV36645 Anti-MCM3 (AB2) antibody produced in rabbit affinity isolated antibody canine, mouse, horse, guinea pig, rabbit, bovine, human, rat
immunohistochemistry, western blot pricing
SAB1412541 ANTI-MCM3 antibody produced in mouse clone 2A11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412669 ANTI-MCM3 antibody produced in mouse clone 2H3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2701703 Anti-mcm3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
HPA004789 Anti-MCM3 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
HPA004790 Anti-MCM3 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
PLA0038 Goat anti-MCM3 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, chimpanzee, gorilla, horse, primate, rhesus monkey, pig, gibbon
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
WH0004172M1 Monoclonal Anti-MCM3 antibody produced in mouse clone 4F7, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, western blot pricing
SAB1404055 Monoclonal Anti-MCM3, (C-terminal) antibody produced in mouse clone 3E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0061 Rabbit anti-MCM3 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. toad, horse, chimpanzee, human, rhesus monkey, gibbon, pig, primate, gorilla
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002388 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002388 Rosetta Predictions human pricing
XM_001070728 Rosetta Predictions rat pricing
XM_236988 Rosetta Predictions rat pricing
NM_008563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230231 predicted 565
2 SASI_Hs01_00230233 predicted 888
3 SASI_Hs01_00230235 predicted 501
4 SASI_Hs01_00230236 predicted 1118
5 SASI_Hs01_00230237 predicted 1672
6 SASI_Hs01_00230239 predicted 358
7 SASI_Hs01_00230240 predicted 261
8 SASI_Hs02_00333742 predicted 1538
9 SASI_Hs02_00333743 predicted 231
10 SASI_Hs02_00333744 predicted 1462
11 SASI_Hs01_00230232 predicted 2573
12 SASI_Hs01_00230234 predicted 776
13 SASI_Hs01_00230238 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332605 predicted 1031
2 SASI_Rn02_00332606 predicted 267
3 SASI_Rn02_00332607 predicted 950
4 SASI_Rn02_00332608 predicted 204
5 SASI_Rn02_00332609 predicted 1123
6 SASI_Rn02_00332610 predicted 2420
7 SASI_Rn02_00332611 predicted 243
8 SASI_Rn02_00332612 predicted 573
9 SASI_Rn02_00332613 predicted 2221
10 SASI_Rn02_00332614 predicted 2239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390590 predicted 560
2 SASI_Rn02_00390591 predicted 967
3 SASI_Rn02_00390592 predicted 1555
4 SASI_Rn02_00390593 predicted 201
5 SASI_Rn02_00390594 predicted 883
6 SASI_Rn02_00390595 predicted 2194
7 SASI_Rn02_00390596 predicted 2357
8 SASI_Rn02_00390597 predicted 510
9 SASI_Rn02_00390598 predicted 2160
10 SASI_Rn02_00390599 predicted 2172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105535 predicted 1629
2 SASI_Mm01_00105536 predicted 1010
3 SASI_Mm01_00105537 predicted 2322
4 SASI_Mm01_00105539 predicted 1599
5 SASI_Mm01_00105541 predicted 820
6 SASI_Mm01_00105540 predicted 2328
7 SASI_Mm02_00314163 predicted 514
8 SASI_Mm01_00105542 predicted 281
9 SASI_Mm01_00105543 predicted 1361
10 SASI_Mm01_00105544 predicted 2091
11 SASI_Mm01_00105538 predicted 1511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002388
VALIDATED
MCM3 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002388.3-363s1c1
Sequence:CCGGGCCTCCATTGATGCTACCTATCTCGAGATAGGTAGCATCAATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002388.3-2486s1c1
Sequence:CCGGGCAGGATGACAATCAGGTCATCTCGAGATGACCTGATTGTCATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002388.3-1478s1c1
Sequence:CCGGCGGCAGGTATGACCAGTATAACTCGAGTTATACTGGTCATACCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002388.3-1692s1c1
Sequence:CCGGGCCACAGATGATCCCAACTTTCTCGAGAAAGTTGGGATCATCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002388.3-194s1c1
Sequence:CCGGCCAGGGAATTTATCAGAGCAACTCGAGTTGCTCTGATAAATTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-1692s21c1
Sequence:CCGGGCCACAGATGATCCCAACTTTCTCGAGAAAGTTGGGATCATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-363s21c1
Sequence:CCGGGCCTCCATTGATGCTACCTATCTCGAGATAGGTAGCATCAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-1478s21c1
Sequence:CCGGCGGCAGGTATGACCAGTATAACTCGAGTTATACTGGTCATACCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-2486s21c1
Sequence:CCGGGCAGGATGACAATCAGGTCATCTCGAGATGACCTGATTGTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002388
VALIDATED
MCM3 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002388.3-363s1c1
Sequence:CCGGGCCTCCATTGATGCTACCTATCTCGAGATAGGTAGCATCAATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002388.3-2486s1c1
Sequence:CCGGGCAGGATGACAATCAGGTCATCTCGAGATGACCTGATTGTCATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002388.3-1478s1c1
Sequence:CCGGCGGCAGGTATGACCAGTATAACTCGAGTTATACTGGTCATACCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002388.3-1692s1c1
Sequence:CCGGGCCACAGATGATCCCAACTTTCTCGAGAAAGTTGGGATCATCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002388.3-194s1c1
Sequence:CCGGCCAGGGAATTTATCAGAGCAACTCGAGTTGCTCTGATAAATTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-1692s21c1
Sequence:CCGGGCCACAGATGATCCCAACTTTCTCGAGAAAGTTGGGATCATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-363s21c1
Sequence:CCGGGCCTCCATTGATGCTACCTATCTCGAGATAGGTAGCATCAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-1478s21c1
Sequence:CCGGCGGCAGGTATGACCAGTATAACTCGAGTTATACTGGTCATACCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-2486s21c1
Sequence:CCGGGCAGGATGACAATCAGGTCATCTCGAGATGACCTGATTGTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002388
VALIDATED
MCM3 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002388.3-363s1c1
Sequence:CCGGGCCTCCATTGATGCTACCTATCTCGAGATAGGTAGCATCAATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002388.3-2486s1c1
Sequence:CCGGGCAGGATGACAATCAGGTCATCTCGAGATGACCTGATTGTCATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002388.3-1478s1c1
Sequence:CCGGCGGCAGGTATGACCAGTATAACTCGAGTTATACTGGTCATACCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002388.3-1692s1c1
Sequence:CCGGGCCACAGATGATCCCAACTTTCTCGAGAAAGTTGGGATCATCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002388.3-194s1c1
Sequence:CCGGCCAGGGAATTTATCAGAGCAACTCGAGTTGCTCTGATAAATTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-1692s21c1
Sequence:CCGGGCCACAGATGATCCCAACTTTCTCGAGAAAGTTGGGATCATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-363s21c1
Sequence:CCGGGCCTCCATTGATGCTACCTATCTCGAGATAGGTAGCATCAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-1478s21c1
Sequence:CCGGCGGCAGGTATGACCAGTATAACTCGAGTTATACTGGTCATACCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002388.3-2486s21c1
Sequence:CCGGGCAGGATGACAATCAGGTCATCTCGAGATGACCTGATTGTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008563
VALIDATED
MCM3 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008563.1-2689s1c1
Sequence:CCGGCCTGCGTTTGTTACTTGTGTTCTCGAGAACACAAGTAACAAACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008563.1-514s1c1
Sequence:CCGGCCAGTTCTGTTTATCCCACAACTCGAGTTGTGGGATAAACAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008563.1-1212s1c1
Sequence:CCGGCGTGGAGTGGTTTGCATTGATCTCGAGATCAATGCAAACCACTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-2482s21c1
Sequence:CCGGTGTCTCCCATCCTCCAGTAACCTCGAGGTTACTGGAGGATGGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-1422s21c1
Sequence:CCGGGACTCACTGCTGTCTAGATTTCTCGAGAAATCTAGACAGCAGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-1008s21c1
Sequence:CCGGATCCGTGGAGACATCAATATTCTCGAGAATATTGATGTCTCCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-1620s21c1
Sequence:CCGGCAGCAAGATACCCGCATTTATCTCGAGATAAATGCGGGTATCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-828s21c1
Sequence:CCGGGCATTCTCTGCGGACGATATACTCGAGTATATCGTCCGCAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008563
VALIDATED
MCM3 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008563.1-2689s1c1
Sequence:CCGGCCTGCGTTTGTTACTTGTGTTCTCGAGAACACAAGTAACAAACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008563.1-514s1c1
Sequence:CCGGCCAGTTCTGTTTATCCCACAACTCGAGTTGTGGGATAAACAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008563.1-1212s1c1
Sequence:CCGGCGTGGAGTGGTTTGCATTGATCTCGAGATCAATGCAAACCACTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-2482s21c1
Sequence:CCGGTGTCTCCCATCCTCCAGTAACCTCGAGGTTACTGGAGGATGGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-1422s21c1
Sequence:CCGGGACTCACTGCTGTCTAGATTTCTCGAGAAATCTAGACAGCAGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-1008s21c1
Sequence:CCGGATCCGTGGAGACATCAATATTCTCGAGAATATTGATGTCTCCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-1620s21c1
Sequence:CCGGCAGCAAGATACCCGCATTTATCTCGAGATAAATGCGGGTATCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-828s21c1
Sequence:CCGGGCATTCTCTGCGGACGATATACTCGAGTATATCGTCCGCAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008563
VALIDATED
MCM3 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008563.1-2689s1c1
Sequence:CCGGCCTGCGTTTGTTACTTGTGTTCTCGAGAACACAAGTAACAAACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008563.1-514s1c1
Sequence:CCGGCCAGTTCTGTTTATCCCACAACTCGAGTTGTGGGATAAACAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008563.1-1212s1c1
Sequence:CCGGCGTGGAGTGGTTTGCATTGATCTCGAGATCAATGCAAACCACTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-2482s21c1
Sequence:CCGGTGTCTCCCATCCTCCAGTAACCTCGAGGTTACTGGAGGATGGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-1422s21c1
Sequence:CCGGGACTCACTGCTGTCTAGATTTCTCGAGAAATCTAGACAGCAGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-1008s21c1
Sequence:CCGGATCCGTGGAGACATCAATATTCTCGAGAATATTGATGTCTCCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-1620s21c1
Sequence:CCGGCAGCAAGATACCCGCATTTATCTCGAGATAAATGCGGGTATCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008563.2-828s21c1
Sequence:CCGGGCATTCTCTGCGGACGATATACTCGAGTATATCGTCCGCAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks