EMAIL THIS PAGE TO A FRIEND

MCTP1

multiple C2 domains, transmembrane 1

UniProtKB ID: Q6DN14, Q6DN13, Q8N2W1, Q8NBA2, Q96LX0, Q9H6E8
Gene ID:
Mouse(78771) multiple C2 domains, transmembrane 1
Rat(309928) multiple C2 domains, transmembrane 1
chicken(427113) multiple C2 domains, transmembrane 1
cow(533635) multiple C2 domains, transmembrane 1
domestic cat(101087450) multiple C2 domains, transmembrane 1
dog(488906) multiple C2 domains, transmembrane 1
sheep(101122523) multiple C2 domains, transmembrane 1
domestic guinea pig(100721205) multiple C2 domains, transmembrane 1
naked mole-rat(101696579) multiple C2 domains, transmembrane 1
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024717 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002796 Rosetta Predictions human pricing
NM_024717 Rosetta Predictions human pricing
XM_001054964 Rosetta Predictions rat pricing
XM_226612 Rosetta Predictions rat pricing
NM_030174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198696 predicted 1164
2 SASI_Hs02_00304198 predicted 1177
3 SASI_Hs01_00198698 predicted 1577
4 SASI_Hs01_00198699 predicted 401
5 SASI_Hs01_00198700 predicted 1487
6 SASI_Hs01_00198701 predicted 1310
7 SASI_Hs01_00198702 predicted 1454
8 SASI_Hs02_00304199 predicted 1381
9 SASI_Hs01_00198704 predicted 1842
10 SASI_Hs01_00198705 predicted 1539
11 SASI_Hs01_00198697 predicted 1686
12 SASI_Hs01_00198703 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103674 predicted 1825
2 SASI_Hs02_00357176 predicted 1834
3 SASI_Hs01_00103676 predicted 2235
4 SASI_Hs01_00103677 predicted 1065
5 SASI_Hs01_00103678 predicted 2150
6 SASI_Hs01_00103679 predicted 1968
7 SASI_Hs01_00103680 predicted 2117
8 SASI_Hs02_00357177 predicted 2048
9 SASI_Hs01_00103682 predicted 2507
10 SASI_Hs01_00103683 predicted 2201
11 SASI_Hs01_00103675 predicted 2347
12 SASI_Hs01_00103681 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277842 predicted 1172
2 SASI_Rn02_00277843 predicted 1113
3 SASI_Rn02_00277844 predicted 1397
4 SASI_Rn02_00277845 predicted 1323
5 SASI_Rn02_00277846 predicted 1601
6 SASI_Rn02_00277847 predicted 1516
7 SASI_Rn02_00277848 predicted 1661
8 SASI_Rn02_00277849 predicted 1284
9 SASI_Rn02_00277850 predicted 1433
10 SASI_Rn02_00277851 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166966 predicted 1113
2 SASI_Rn01_00166967 predicted 1337
3 SASI_Rn01_00166968 predicted 206
4 SASI_Rn01_00166969 predicted 1271
5 SASI_Rn01_00166970 predicted 1456
6 SASI_Rn01_00166971 predicted 568
7 SASI_Rn01_00166972 predicted 1222
8 SASI_Rn01_00166973 predicted 1199
9 SASI_Rn01_00166974 predicted 1260
10 SASI_Rn01_00166975 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044064 predicted 521
2 SASI_Mm02_00336583 predicted 1255
3 SASI_Mm01_00044065 predicted 1543
4 SASI_Mm01_00044066 predicted 1741
5 SASI_Mm01_00044067 predicted 1406
6 SASI_Mm01_00044068 predicted 1663
7 SASI_Mm01_00044070 predicted 1582
8 SASI_Mm01_00044072 predicted 1936
9 SASI_Mm01_00044073 predicted 1466
10 SASI_Mm02_00336584 predicted 1629
11 SASI_Mm01_00044069 predicted 985
12 SASI_Mm01_00044071 predicted 2235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024717
VALIDATED
MCTP1 MISSION shRNA Bacterial Glycerol Stock
multiple C2 domains, transmembrane 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1811s21c1
Sequence:CCGGAGGAACGAGAGGAGATATTAACTCGAGTTAATATCTCCTCTCGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-2369s21c1
Sequence:CCGGATGCTGCATACTACGTTAATACTCGAGTATTAACGTAGTATGCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1837s21c1
Sequence:CCGGTATAGCCCATTGAGGATATTTCTCGAGAAATATCCTCAATGGGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-2506s21c1
Sequence:CCGGTGGAACTACTTCTTGATAATACTCGAGTATTATCAAGAAGTAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-2535s21c1
Sequence:CCGGAGATAACAGGCAACGTGATACCTCGAGGTATCACGTTGCCTGTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1227s21c1
Sequence:CCGGTGAAGTGGTTGGATCTTATTTCTCGAGAAATAAGATCCAACCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1896s21c1
Sequence:CCGGCATCAGAGCGGAAGGGTTAATCTCGAGATTAACCCTTCCGCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024717.x-974s1c1
Sequence:CCGGTGGGACAAAGATGCTGGGAAACTCGAGTTTCCCAGCATCTTTGTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024717.x-528s1c1
Sequence:CCGGCCTTTCTGGATCTGACACAATCTCGAGATTGTGTCAGATCCAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024717.x-2305s1c1
Sequence:CCGGCTCAGCAGCATTTCCTTTCTTCTCGAGAAGAAAGGAAATGCTGCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024717.x-1640s1c1
Sequence:CCGGCAGAAGTACATTGAAGAGGAACTCGAGTTCCTCTTCAATGTACTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024717
VALIDATED
MCTP1 MISSION shRNA shRNA Plasmid DNA
multiple C2 domains, transmembrane 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1811s21c1
Sequence:CCGGAGGAACGAGAGGAGATATTAACTCGAGTTAATATCTCCTCTCGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-2369s21c1
Sequence:CCGGATGCTGCATACTACGTTAATACTCGAGTATTAACGTAGTATGCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1837s21c1
Sequence:CCGGTATAGCCCATTGAGGATATTTCTCGAGAAATATCCTCAATGGGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-2506s21c1
Sequence:CCGGTGGAACTACTTCTTGATAATACTCGAGTATTATCAAGAAGTAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-2535s21c1
Sequence:CCGGAGATAACAGGCAACGTGATACCTCGAGGTATCACGTTGCCTGTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1227s21c1
Sequence:CCGGTGAAGTGGTTGGATCTTATTTCTCGAGAAATAAGATCCAACCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1896s21c1
Sequence:CCGGCATCAGAGCGGAAGGGTTAATCTCGAGATTAACCCTTCCGCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024717.x-974s1c1
Sequence:CCGGTGGGACAAAGATGCTGGGAAACTCGAGTTTCCCAGCATCTTTGTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024717.x-528s1c1
Sequence:CCGGCCTTTCTGGATCTGACACAATCTCGAGATTGTGTCAGATCCAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024717.x-2305s1c1
Sequence:CCGGCTCAGCAGCATTTCCTTTCTTCTCGAGAAGAAAGGAAATGCTGCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024717.x-1640s1c1
Sequence:CCGGCAGAAGTACATTGAAGAGGAACTCGAGTTCCTCTTCAATGTACTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024717
VALIDATED
MCTP1 MISSION shRNA Lentiviral Transduction Particles
multiple C2 domains, transmembrane 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1811s21c1
Sequence:CCGGAGGAACGAGAGGAGATATTAACTCGAGTTAATATCTCCTCTCGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-2369s21c1
Sequence:CCGGATGCTGCATACTACGTTAATACTCGAGTATTAACGTAGTATGCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1837s21c1
Sequence:CCGGTATAGCCCATTGAGGATATTTCTCGAGAAATATCCTCAATGGGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-2506s21c1
Sequence:CCGGTGGAACTACTTCTTGATAATACTCGAGTATTATCAAGAAGTAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-2535s21c1
Sequence:CCGGAGATAACAGGCAACGTGATACCTCGAGGTATCACGTTGCCTGTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1227s21c1
Sequence:CCGGTGAAGTGGTTGGATCTTATTTCTCGAGAAATAAGATCCAACCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024717.4-1896s21c1
Sequence:CCGGCATCAGAGCGGAAGGGTTAATCTCGAGATTAACCCTTCCGCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024717.x-974s1c1
Sequence:CCGGTGGGACAAAGATGCTGGGAAACTCGAGTTTCCCAGCATCTTTGTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024717.x-528s1c1
Sequence:CCGGCCTTTCTGGATCTGACACAATCTCGAGATTGTGTCAGATCCAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024717.x-2305s1c1
Sequence:CCGGCTCAGCAGCATTTCCTTTCTTCTCGAGAAGAAAGGAAATGCTGCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024717.x-1640s1c1
Sequence:CCGGCAGAAGTACATTGAAGAGGAACTCGAGTTCCTCTTCAATGTACTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127419
MCTP1 MISSION shRNA Bacterial Glycerol Stock
multiple C2 domains, transmembrane 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-1413s1c1
Sequence:CCGGGCAATTTGATTTCCATCTCTACTCGAGTAGAGATGGAAATCAAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-2172s1c1
Sequence:CCGGGCTGCTTCTAAGAAACTTTATCTCGAGATAAAGTTTCTTAGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-1199s1c1
Sequence:CCGGCCAGTAAGTTTCAGACCCAAACTCGAGTTTGGGTCTGAAACTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-2659s1c1
Sequence:CCGGCCACTGAGATACATTGTTCTTCTCGAGAAGAACAATGTATCTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-767s1c1
Sequence:CCGGCCGGAATGTACCAGTTGGATACTCGAGTATCCAACTGGTACATTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127419
MCTP1 MISSION shRNA shRNA Plasmid DNA
multiple C2 domains, transmembrane 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-1413s1c1
Sequence:CCGGGCAATTTGATTTCCATCTCTACTCGAGTAGAGATGGAAATCAAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-2172s1c1
Sequence:CCGGGCTGCTTCTAAGAAACTTTATCTCGAGATAAAGTTTCTTAGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-1199s1c1
Sequence:CCGGCCAGTAAGTTTCAGACCCAAACTCGAGTTTGGGTCTGAAACTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-2659s1c1
Sequence:CCGGCCACTGAGATACATTGTTCTTCTCGAGAAGAACAATGTATCTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-767s1c1
Sequence:CCGGCCGGAATGTACCAGTTGGATACTCGAGTATCCAACTGGTACATTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127419
MCTP1 MISSION shRNA Lentiviral Transduction Particles
multiple C2 domains, transmembrane 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-1413s1c1
Sequence:CCGGGCAATTTGATTTCCATCTCTACTCGAGTAGAGATGGAAATCAAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-2172s1c1
Sequence:CCGGGCTGCTTCTAAGAAACTTTATCTCGAGATAAAGTTTCTTAGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-1199s1c1
Sequence:CCGGCCAGTAAGTTTCAGACCCAAACTCGAGTTTGGGTCTGAAACTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-2659s1c1
Sequence:CCGGCCACTGAGATACATTGTTCTTCTCGAGAAGAACAATGTATCTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127419.3-767s1c1
Sequence:CCGGCCGGAATGTACCAGTTGGATACTCGAGTATCCAACTGGTACATTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks