EMAIL THIS PAGE TO A FRIEND

MDK

midkine (neurite growth-promoting factor 2)

Synonyms: ARAP MK NEGF2
UniProtKB ID: P21741, Q2LEK4, Q9UCC7
Gene ID:
Human(4192) Summary: This gene encodes a member of a small family of secreted growth factors that binds heparin and responds to retinoic acid. The encoded protein promotes cell growth, migration, and angiogenesis, in particular during tumorigenesis. This gene has been targeted as a therapeutic for a variety of different disorders. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012]
Mouse(17242) midkine
Rat(81517) midkine
chicken(423196) midkine (neurite growth-promoting factor 2)
cow(618377) midkine-like
cow(280852) midkine (neurite growth-promoting factor 2)
domestic cat(101087941) midkine (neurite growth-promoting factor 2)
domestic guinea pig(100713073) midkine (neurite growth-promoting factor 2)
Domestic Rabbit(100008929) midkine (neurite growth-promoting factor 2)
naked mole-rat(101726780) midkine (neurite growth-promoting factor 2)
sheep(101114137) midkine (neurite growth-promoting factor 2)
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AG243 Midkine, recombinant human 20 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012333 Rosetta Predictions human pricing
NM_001012334 Rosetta Predictions human pricing
NM_002391 Rosetta Predictions human pricing
NM_030859 Rosetta Predictions rat pricing
NM_001012335 Rosetta Predictions mouse pricing
NM_001012336 Rosetta Predictions mouse pricing
NM_010784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094499 predicted 558
2 SASI_Hs01_00094501 predicted 368
3 SASI_Hs02_00306081 predicted 660
4 SASI_Hs01_00094502 predicted 654
5 SASI_Hs01_00094503 predicted 478
6 SASI_Hs01_00094504 predicted 656
7 SASI_Hs02_00306082 predicted 348
8 SASI_Hs01_00094506 predicted 372
9 SASI_Hs01_00094507 predicted 648
10 SASI_Hs02_00306083 predicted 550
11 SASI_Hs01_00094498 predicted 451
12 SASI_Hs01_00094500 predicted 455
13 SASI_Hs01_00094505 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032800 predicted 647
2 SASI_Hs01_00032802 predicted 453
3 SASI_Hs02_00306084 predicted 745
4 SASI_Hs01_00032803 predicted 744
5 SASI_Hs01_00032804 predicted 573
6 SASI_Hs01_00032805 predicted 742
7 SASI_Hs02_00306085 predicted 431
8 SASI_Hs01_00032807 predicted 459
9 SASI_Hs01_00032808 predicted 738
10 SASI_Hs02_00306086 predicted 641
11 SASI_Hs01_00032799 predicted 546
12 SASI_Hs01_00032801 predicted 542
13 SASI_Hs01_00032806 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172412 predicted 512
2 SASI_Hs01_00172414 predicted 323
3 SASI_Hs02_00333747 predicted 614
4 SASI_Hs01_00172415 predicted 613
5 SASI_Hs01_00172416 predicted 442
6 SASI_Hs01_00172417 predicted 613
7 SASI_Hs02_00333748 predicted 306
8 SASI_Hs01_00172419 predicted 328
9 SASI_Hs01_00172420 predicted 610
10 SASI_Hs02_00333749 predicted 505
11 SASI_Hs01_00172411 predicted 414
12 SASI_Hs01_00172413 predicted 413
13 SASI_Hs01_00172418 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057337 predicted 309
2 SASI_Rn01_00057338 predicted 303
3 SASI_Rn01_00057339 predicted 220
4 SASI_Rn02_00264105 predicted 387
5 SASI_Rn01_00057342 predicted 225
6 SASI_Rn02_00264106 predicted 81
7 SASI_Rn01_00057343 predicted 340
8 SASI_Rn02_00264107 predicted 381
9 SASI_Rn01_00057344 predicted 299
10 SASI_Rn01_00057345 predicted 200
11 SASI_Rn01_00057340 predicted 475
12 SASI_Rn01_00057341 predicted 508
13 SASI_Rn01_00057346 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287092 predicted 547
2 SASI_Mm01_00190629 predicted 461
3 SASI_Mm01_00190630 predicted 471
4 SASI_Mm01_00190631 predicted 508
5 SASI_Mm01_00190632 predicted 527
6 SASI_Mm01_00190633 predicted 472
7 SASI_Mm01_00190634 predicted 533
8 SASI_Mm01_00190635 predicted 455
9 SASI_Mm01_00190638 predicted 607
10 SASI_Mm02_00287093 predicted 504
11 SASI_Mm01_00190636 predicted 531
12 SASI_Mm01_00190637 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287094 predicted 483
2 SASI_Mm01_00140487 predicted 396
3 SASI_Mm01_00140488 predicted 408
4 SASI_Mm01_00140489 predicted 434
5 SASI_Mm01_00140490 predicted 461
6 SASI_Mm01_00140491 predicted 405
7 SASI_Mm01_00140492 predicted 466
8 SASI_Mm01_00140493 predicted 397
9 SASI_Mm01_00140496 predicted 544
10 SASI_Mm02_00287095 predicted 431
11 SASI_Mm01_00140494 predicted 467
12 SASI_Mm01_00140495 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319352 predicted 740
2 SASI_Mm01_00060200 predicted 648
3 SASI_Mm01_00060201 predicted 655
4 SASI_Mm01_00060202 predicted 687
5 SASI_Mm01_00060203 predicted 716
6 SASI_Mm01_00060204 predicted 658
7 SASI_Mm01_00060205 predicted 716
8 SASI_Mm01_00060206 predicted 644
9 SASI_Mm01_00060209 predicted 797
10 SASI_Mm02_00319353 predicted 689
11 SASI_Mm01_00060207 predicted 721
12 SASI_Mm01_00060208 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002391
VALIDATED
MDK MISSION shRNA Bacterial Glycerol Stock
midkine (neurite growth-promoting factor 2)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-505s21c1
Sequence:CCGGAGGGAAGGGAAAGGACTAGACCTCGAGGTCTAGTCCTTTCCCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-621s21c1
Sequence:CCGGTGTCTGCTCGTTAGCTTTAATCTCGAGATTAAAGCTAACGAGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-238s21c1
Sequence:CCGGCAAGGATTGCGGCGTGGGTTTCTCGAGAAACCCACGCCGCAATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-337s21c1
Sequence:CCGGCGACTGCAAGTACAAGTTTGACTCGAGTCAAACTTGTACTTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002391.3-421s21c1
Sequence:CCGGGCGCTACAATGCTCAGTGCCACTCGAGTGGCACTGAGCATTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-271s1c1
Sequence:CCGGCGACTGCAAGTACAAGTTTGACTCGAGTCAAACTTGTACTTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-355s1c1
Sequence:CCGGGCGCTACAATGCTCAGTGCCACTCGAGTGGCACTGAGCATTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-409s1c1
Sequence:CCGGCAAGACCAAAGCAAAGGCCAACTCGAGTTGGCCTTTGCTTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-317s1c1
Sequence:CCGGACAGGCACCAAAGTCCGCCAACTCGAGTTGGCGGACTTTGGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002391
VALIDATED
MDK MISSION shRNA shRNA Plasmid DNA
midkine (neurite growth-promoting factor 2)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-505s21c1
Sequence:CCGGAGGGAAGGGAAAGGACTAGACCTCGAGGTCTAGTCCTTTCCCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-621s21c1
Sequence:CCGGTGTCTGCTCGTTAGCTTTAATCTCGAGATTAAAGCTAACGAGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-238s21c1
Sequence:CCGGCAAGGATTGCGGCGTGGGTTTCTCGAGAAACCCACGCCGCAATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-337s21c1
Sequence:CCGGCGACTGCAAGTACAAGTTTGACTCGAGTCAAACTTGTACTTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002391.3-421s21c1
Sequence:CCGGGCGCTACAATGCTCAGTGCCACTCGAGTGGCACTGAGCATTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-271s1c1
Sequence:CCGGCGACTGCAAGTACAAGTTTGACTCGAGTCAAACTTGTACTTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-355s1c1
Sequence:CCGGGCGCTACAATGCTCAGTGCCACTCGAGTGGCACTGAGCATTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-409s1c1
Sequence:CCGGCAAGACCAAAGCAAAGGCCAACTCGAGTTGGCCTTTGCTTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-317s1c1
Sequence:CCGGACAGGCACCAAAGTCCGCCAACTCGAGTTGGCGGACTTTGGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002391
VALIDATED
MDK MISSION shRNA Lentiviral Transduction Particles
midkine (neurite growth-promoting factor 2)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-505s21c1
Sequence:CCGGAGGGAAGGGAAAGGACTAGACCTCGAGGTCTAGTCCTTTCCCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-621s21c1
Sequence:CCGGTGTCTGCTCGTTAGCTTTAATCTCGAGATTAAAGCTAACGAGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-238s21c1
Sequence:CCGGCAAGGATTGCGGCGTGGGTTTCTCGAGAAACCCACGCCGCAATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002391.3-337s21c1
Sequence:CCGGCGACTGCAAGTACAAGTTTGACTCGAGTCAAACTTGTACTTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002391.3-421s21c1
Sequence:CCGGGCGCTACAATGCTCAGTGCCACTCGAGTGGCACTGAGCATTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-271s1c1
Sequence:CCGGCGACTGCAAGTACAAGTTTGACTCGAGTCAAACTTGTACTTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-355s1c1
Sequence:CCGGGCGCTACAATGCTCAGTGCCACTCGAGTGGCACTGAGCATTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-409s1c1
Sequence:CCGGCAAGACCAAAGCAAAGGCCAACTCGAGTTGGCCTTTGCTTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002391.2-317s1c1
Sequence:CCGGACAGGCACCAAAGTCCGCCAACTCGAGTTGGCGGACTTTGGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010784
MDK MISSION shRNA Bacterial Glycerol Stock
midkine (neurite growth-promoting factor 2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010784.4-842s1c1
Sequence:CCGGCCCAAGATATAACCCACCAGTCTCGAGACTGGTGGGTTATATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-734s1c1
Sequence:CCGGCCAAGTCAAAGACCAAAGCCACTCGAGTGGCTTTGGTCTTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-563s1c1
Sequence:CCGGCCTGCAACTGGAAGAAGGAATCTCGAGATTCCTTCTTCCAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-723s1c1
Sequence:CCGGCACCTCCAAGACCAAGTCAAACTCGAGTTTGACTTGGTCTTGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-589s1c1
Sequence:CCGGGCCGACTGCAAATACAAGTTTCTCGAGAAACTTGTATTTGCAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010784
MDK MISSION shRNA shRNA Plasmid DNA
midkine (neurite growth-promoting factor 2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010784.4-842s1c1
Sequence:CCGGCCCAAGATATAACCCACCAGTCTCGAGACTGGTGGGTTATATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-734s1c1
Sequence:CCGGCCAAGTCAAAGACCAAAGCCACTCGAGTGGCTTTGGTCTTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-563s1c1
Sequence:CCGGCCTGCAACTGGAAGAAGGAATCTCGAGATTCCTTCTTCCAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-723s1c1
Sequence:CCGGCACCTCCAAGACCAAGTCAAACTCGAGTTTGACTTGGTCTTGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-589s1c1
Sequence:CCGGGCCGACTGCAAATACAAGTTTCTCGAGAAACTTGTATTTGCAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010784
MDK MISSION shRNA Lentiviral Transduction Particles
midkine (neurite growth-promoting factor 2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010784.4-842s1c1
Sequence:CCGGCCCAAGATATAACCCACCAGTCTCGAGACTGGTGGGTTATATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-734s1c1
Sequence:CCGGCCAAGTCAAAGACCAAAGCCACTCGAGTGGCTTTGGTCTTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-563s1c1
Sequence:CCGGCCTGCAACTGGAAGAAGGAATCTCGAGATTCCTTCTTCCAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-723s1c1
Sequence:CCGGCACCTCCAAGACCAAGTCAAACTCGAGTTTGACTTGGTCTTGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010784.4-589s1c1
Sequence:CCGGGCCGACTGCAAATACAAGTTTCTCGAGAAACTTGTATTTGCAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks