EMAIL THIS PAGE TO A FRIEND

MDM1

Mdm1 nuclear protein homolog (mouse)

UniProtKB ID: Q8TC05, B4DM65, E7EPQ3, O43406, Q8WTV9, Q9NR04
Gene ID:
Human(56890) Summary: This gene encodes a nuclear protein similar to the mouse double minute 1 protein. The mouse gene is located in double minute (DM) chromatin particles, is amplified in the mouse transformed 3T3 cell line, and the encoded protein is able to bind to p53. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(17245) transformed mouse 3T3 cell double minute 1
Rat(314859) Mdm1 nuclear protein homolog (mouse)
sheep(101106759) Mdm1 nuclear protein homolog (mouse)
naked mole-rat(101699999) Mdm1 nuclear protein homolog (mouse)
domestic guinea pig(100725769) Mdm1 nuclear protein homolog (mouse)
Zebrafish(557148) transformed 3T3 cell double minute 1 homolog (mouse)
dog(474439) Mdm1 nuclear protein homolog (mouse)
domestic cat(101095425) Mdm1 nuclear protein homolog (mouse)
cow(614357) Mdm1 nuclear protein homolog (mouse)
chicken(417839) Mdm1 nuclear protein homolog (mouse)
210 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017440 Rosetta Predictions human pricing
NM_020128 Rosetta Predictions human pricing
NM_001017459 Rosetta Predictions rat pricing
NM_010785 Rosetta Predictions mouse pricing
NM_148922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350034 predicted 251
2 SASI_Hs02_00350035 predicted 246
3 SASI_Hs02_00350036 predicted 229
4 SASI_Hs02_00350037 predicted 252
5 SASI_Hs02_00350038 predicted 246
6 SASI_Hs02_00350039 predicted 310
7 SASI_Hs02_00350040 predicted 235
8 SASI_Hs02_00350041 predicted 304
9 SASI_Hs02_00350042 predicted 347
10 SASI_Hs02_00350043 predicted 364
11 SASI_Hs01_00219512 predicted 1667
12 SASI_Hs01_00219513 predicted 622
13 SASI_Hs01_00219514 predicted 1430
14 SASI_Hs01_00219515 predicted 577
15 SASI_Hs01_00219516 predicted 2257
16 SASI_Hs01_00219517 predicted 2126
17 SASI_Hs01_00219518 predicted 2161
18 SASI_Hs01_00219519 predicted 1364
19 SASI_Hs01_00219520 predicted 1087
20 SASI_Hs01_00219521 predicted 1815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352993 predicted 256
2 SASI_Hs02_00352994 predicted 247
3 SASI_Hs02_00352995 predicted 231
4 SASI_Hs02_00352996 predicted 260
5 SASI_Hs02_00352997 predicted 242
6 SASI_Hs02_00352998 predicted 306
7 SASI_Hs02_00352999 predicted 232
8 SASI_Hs02_00353000 predicted 300
9 SASI_Hs02_00353001 predicted 344
10 SASI_Hs02_00353002 predicted 356
11 SASI_Hs01_00096424 predicted 229
12 SASI_Hs01_00096425 predicted 836
13 SASI_Hs01_00096426 predicted 774
14 SASI_Hs01_00096427 predicted 479
15 SASI_Hs01_00096428 predicted 705
16 SASI_Hs01_00096429 predicted 760
17 SASI_Hs01_00096430 predicted 526
18 SASI_Hs01_00096431 predicted 948
19 SASI_Hs01_00096432 predicted 952
20 SASI_Hs01_00096433 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051003 predicted 2088
2 SASI_Rn01_00051004 predicted 1597
3 SASI_Rn02_00202255 predicted 385
4 SASI_Rn01_00051006 predicted 1224
5 SASI_Rn02_00202256 predicted 866
6 SASI_Rn01_00051008 predicted 906
7 SASI_Rn01_00051009 predicted 785
8 SASI_Rn01_00051010 predicted 836
9 SASI_Rn01_00051011 predicted 1098
10 SASI_Rn01_00051012 predicted 1144
11 SASI_Rn01_00051005 predicted 1259
12 SASI_Rn01_00051007 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188749 predicted 197
2 SASI_Mm01_00188750 predicted 222
3 SASI_Mm01_00188751 predicted 368
4 SASI_Mm01_00188752 predicted 314
5 SASI_Mm01_00188753 predicted 315
6 SASI_Mm01_00188754 predicted 410
7 SASI_Mm01_00188755 predicted 237
8 SASI_Mm01_00188756 predicted 461
9 SASI_Mm01_00188757 predicted 249
10 SASI_Mm01_00188758 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178199 predicted 2084
2 SASI_Mm01_00178200 predicted 814
3 SASI_Mm01_00178201 predicted 224
4 SASI_Mm01_00178202 predicted 666
5 SASI_Mm02_00342719 predicted 2048
6 SASI_Mm01_00178203 predicted 1055
7 SASI_Mm01_00178204 predicted 2320
8 SASI_Mm01_00178205 predicted 459
9 SASI_Mm01_00178206 predicted 403
10 SASI_Mm01_00178207 predicted 329
11 SASI_Mm01_00178208 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017440
VALIDATED
MDM1 MISSION shRNA Bacterial Glycerol Stock
Mdm1 nuclear protein homolog (mouse)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_017440.2-1878s1c1
Sequence:CCGGGCGGGAAGATTCTGAAGACAACTCGAGTTGTCTTCAGAATCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017440.2-196s1c1
Sequence:CCGGGCTGGACTTAGATCAGATCAACTCGAGTTGATCTGATCTAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017440.2-970s1c1
Sequence:CCGGCCTTGGAAACATCAAAGGCTTCTCGAGAAGCCTTTGATGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_017440.2-2246s1c1
Sequence:CCGGGCCTTTATCTAAGGAAACATTCTCGAGAATGTTTCCTTAGATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_017440.2-221s1c1
Sequence:CCGGGCATCACGAAAGAGCCAAGTTCTCGAGAACTTGGCTCTTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017440.4-2425s21c1
Sequence:CCGGATTGTTAACATAGGCTTATACCTCGAGGTATAAGCCTATGTTAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1128s21c1
Sequence:CCGGACATGCCAAATCAGGTTAAAGCTCGAGCTTTAACCTGATTTGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1808s21c1
Sequence:CCGGATGACCTCTCAGGATTGTTTACTCGAGTAAACAATCCTGAGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1206s21c1
Sequence:CCGGGGGACCATCTGAATCAGATTTCTCGAGAAATCTGATTCAGATGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1590s21c1
Sequence:CCGGAGTTGGATGTACGTGAGAAATCTCGAGATTTCTCACGTACATCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-312s21c1
Sequence:CCGGCTTACCATGACCCACAGATTTCTCGAGAAATCTGTGGGTCATGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-197s21c1
Sequence:CCGGTATTTGTCCGAGTCTTGTAATCTCGAGATTACAAGACTCGGACAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-924s21c1
Sequence:CCGGCTCCTGAAAGGAAGAGTAATACTCGAGTATTACTCTTCCTTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017440.4-2486s21c1
Sequence:CCGGAGTACAAAGACCTAGATTATTCTCGAGAATAATCTAGGTCTTTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-557s21c1
Sequence:CCGGACAAACCATACACCAGTTAATCTCGAGATTAACTGGTGTATGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017440
VALIDATED
MDM1 MISSION shRNA shRNA Plasmid DNA
Mdm1 nuclear protein homolog (mouse)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_017440.2-1878s1c1
Sequence:CCGGGCGGGAAGATTCTGAAGACAACTCGAGTTGTCTTCAGAATCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017440.2-196s1c1
Sequence:CCGGGCTGGACTTAGATCAGATCAACTCGAGTTGATCTGATCTAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017440.2-970s1c1
Sequence:CCGGCCTTGGAAACATCAAAGGCTTCTCGAGAAGCCTTTGATGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_017440.2-2246s1c1
Sequence:CCGGGCCTTTATCTAAGGAAACATTCTCGAGAATGTTTCCTTAGATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_017440.2-221s1c1
Sequence:CCGGGCATCACGAAAGAGCCAAGTTCTCGAGAACTTGGCTCTTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017440.4-2425s21c1
Sequence:CCGGATTGTTAACATAGGCTTATACCTCGAGGTATAAGCCTATGTTAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1128s21c1
Sequence:CCGGACATGCCAAATCAGGTTAAAGCTCGAGCTTTAACCTGATTTGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1808s21c1
Sequence:CCGGATGACCTCTCAGGATTGTTTACTCGAGTAAACAATCCTGAGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1206s21c1
Sequence:CCGGGGGACCATCTGAATCAGATTTCTCGAGAAATCTGATTCAGATGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1590s21c1
Sequence:CCGGAGTTGGATGTACGTGAGAAATCTCGAGATTTCTCACGTACATCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-312s21c1
Sequence:CCGGCTTACCATGACCCACAGATTTCTCGAGAAATCTGTGGGTCATGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-197s21c1
Sequence:CCGGTATTTGTCCGAGTCTTGTAATCTCGAGATTACAAGACTCGGACAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-924s21c1
Sequence:CCGGCTCCTGAAAGGAAGAGTAATACTCGAGTATTACTCTTCCTTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017440.4-2486s21c1
Sequence:CCGGAGTACAAAGACCTAGATTATTCTCGAGAATAATCTAGGTCTTTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-557s21c1
Sequence:CCGGACAAACCATACACCAGTTAATCTCGAGATTAACTGGTGTATGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017440
VALIDATED
MDM1 MISSION shRNA Lentiviral Transduction Particles
Mdm1 nuclear protein homolog (mouse)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_017440.2-1878s1c1
Sequence:CCGGGCGGGAAGATTCTGAAGACAACTCGAGTTGTCTTCAGAATCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017440.2-196s1c1
Sequence:CCGGGCTGGACTTAGATCAGATCAACTCGAGTTGATCTGATCTAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017440.2-970s1c1
Sequence:CCGGCCTTGGAAACATCAAAGGCTTCTCGAGAAGCCTTTGATGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_017440.2-2246s1c1
Sequence:CCGGGCCTTTATCTAAGGAAACATTCTCGAGAATGTTTCCTTAGATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_017440.2-221s1c1
Sequence:CCGGGCATCACGAAAGAGCCAAGTTCTCGAGAACTTGGCTCTTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017440.4-2425s21c1
Sequence:CCGGATTGTTAACATAGGCTTATACCTCGAGGTATAAGCCTATGTTAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1128s21c1
Sequence:CCGGACATGCCAAATCAGGTTAAAGCTCGAGCTTTAACCTGATTTGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1808s21c1
Sequence:CCGGATGACCTCTCAGGATTGTTTACTCGAGTAAACAATCCTGAGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1206s21c1
Sequence:CCGGGGGACCATCTGAATCAGATTTCTCGAGAAATCTGATTCAGATGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-1590s21c1
Sequence:CCGGAGTTGGATGTACGTGAGAAATCTCGAGATTTCTCACGTACATCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-312s21c1
Sequence:CCGGCTTACCATGACCCACAGATTTCTCGAGAAATCTGTGGGTCATGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-197s21c1
Sequence:CCGGTATTTGTCCGAGTCTTGTAATCTCGAGATTACAAGACTCGGACAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-924s21c1
Sequence:CCGGCTCCTGAAAGGAAGAGTAATACTCGAGTATTACTCTTCCTTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017440.4-2486s21c1
Sequence:CCGGAGTACAAAGACCTAGATTATTCTCGAGAATAATCTAGGTCTTTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017440.4-557s21c1
Sequence:CCGGACAAACCATACACCAGTTAATCTCGAGATTAACTGGTGTATGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010785
MDM1 MISSION shRNA Bacterial Glycerol Stock
Mdm1 nuclear protein homolog (mouse)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-371s1c1
Sequence:CCGGCCAAGAGAACTCGGTCTCATTCTCGAGAATGAGACCGAGTTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-78s1c1
Sequence:CCGGGTCCTATTTGTCAGAGTCTTACTCGAGTAAGACTCTGACAAATAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-370s1c1
Sequence:CCGGCCCAAGAGAACTCGGTCTCATCTCGAGATGAGACCGAGTTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-79s1c1
Sequence:CCGGTCCTATTTGTCAGAGTCTTATCTCGAGATAAGACTCTGACAAATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-535s1c1
Sequence:CCGGGATAGGCATCTTCGTAAGAAACTCGAGTTTCTTACGAAGATGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-702s21c1
Sequence:CCGGGCCGTTGTTCCCACGAATAATCTCGAGATTATTCGTGGGAACAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010785.2-2408s21c1
Sequence:CCGGTGCACTTGTCTGAGTACAAAGCTCGAGCTTTGTACTCAGACAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-509s21c1
Sequence:CCGGCAAGAGAACTCGGTCTCATTCCTCGAGGAATGAGACCGAGTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-863s21c1
Sequence:CCGGGACTGAATACAAGCGAAATTTCTCGAGAAATTTCGCTTGTATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-1233s21c1
Sequence:CCGGGACCATCTGAACCAGATTATGCTCGAGCATAATCTGGTTCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010785
MDM1 MISSION shRNA shRNA Plasmid DNA
Mdm1 nuclear protein homolog (mouse)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-371s1c1
Sequence:CCGGCCAAGAGAACTCGGTCTCATTCTCGAGAATGAGACCGAGTTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-78s1c1
Sequence:CCGGGTCCTATTTGTCAGAGTCTTACTCGAGTAAGACTCTGACAAATAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-370s1c1
Sequence:CCGGCCCAAGAGAACTCGGTCTCATCTCGAGATGAGACCGAGTTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-79s1c1
Sequence:CCGGTCCTATTTGTCAGAGTCTTATCTCGAGATAAGACTCTGACAAATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-535s1c1
Sequence:CCGGGATAGGCATCTTCGTAAGAAACTCGAGTTTCTTACGAAGATGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-702s21c1
Sequence:CCGGGCCGTTGTTCCCACGAATAATCTCGAGATTATTCGTGGGAACAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010785.2-2408s21c1
Sequence:CCGGTGCACTTGTCTGAGTACAAAGCTCGAGCTTTGTACTCAGACAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-509s21c1
Sequence:CCGGCAAGAGAACTCGGTCTCATTCCTCGAGGAATGAGACCGAGTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-863s21c1
Sequence:CCGGGACTGAATACAAGCGAAATTTCTCGAGAAATTTCGCTTGTATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-1233s21c1
Sequence:CCGGGACCATCTGAACCAGATTATGCTCGAGCATAATCTGGTTCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010785
MDM1 MISSION shRNA Lentiviral Transduction Particles
Mdm1 nuclear protein homolog (mouse)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-371s1c1
Sequence:CCGGCCAAGAGAACTCGGTCTCATTCTCGAGAATGAGACCGAGTTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-78s1c1
Sequence:CCGGGTCCTATTTGTCAGAGTCTTACTCGAGTAAGACTCTGACAAATAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-370s1c1
Sequence:CCGGCCCAAGAGAACTCGGTCTCATCTCGAGATGAGACCGAGTTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-79s1c1
Sequence:CCGGTCCTATTTGTCAGAGTCTTATCTCGAGATAAGACTCTGACAAATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010785.1-535s1c1
Sequence:CCGGGATAGGCATCTTCGTAAGAAACTCGAGTTTCTTACGAAGATGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-702s21c1
Sequence:CCGGGCCGTTGTTCCCACGAATAATCTCGAGATTATTCGTGGGAACAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010785.2-2408s21c1
Sequence:CCGGTGCACTTGTCTGAGTACAAAGCTCGAGCTTTGTACTCAGACAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-509s21c1
Sequence:CCGGCAAGAGAACTCGGTCTCATTCCTCGAGGAATGAGACCGAGTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-863s21c1
Sequence:CCGGGACTGAATACAAGCGAAATTTCTCGAGAAATTTCGCTTGTATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010785.2-1233s21c1
Sequence:CCGGGACCATCTGAACCAGATTATGCTCGAGCATAATCTGGTTCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks