EMAIL THIS PAGE TO A FRIEND

MED12L

mediator complex subunit 12-like

Synonyms: NOPAR TNRC11L TRALP TRALPUSH
UniProtKB ID: Q86YW9, Q96PC7, Q96PC8, Q9H9M5, Q9HCD7, Q9UI69
Gene ID:
Human(116931) Summary: The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Mouse(329650) mediator of RNA polymerase II transcription, subunit 12 homolog (yeast)-like
Rat(690752) mediator complex subunit 12-like
chicken(425036) mediator complex subunit 12-like
dog(100683791) mediator complex subunit 12-like
Horse(100056881) mediator complex subunit 12-like
cow(538979) mediator complex subunit 12-like
domestic cat(101096834) mediator complex subunit 12-like
domestic guinea pig(101788703) mediator complex subunit 12-like
Domestic Rabbit(100339660) mediator complex subunit 12-like
naked mole-rat(101703502) mediator complex subunit 12-like
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036807 Anti-MED12L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_887994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_887994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_887994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053002 Rosetta Predictions human pricing
XM_001075506 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361830 predicted 3764
2 SASI_Hs01_00144620 predicted 2208
3 SASI_Hs01_00144621 predicted 4885
4 SASI_Hs01_00144624 predicted 5517
5 SASI_Hs01_00144625 predicted 4828
6 SASI_Hs02_00361831 predicted 514
7 SASI_Hs01_00144626 predicted 2141
8 SASI_Hs01_00144627 predicted 2565
9 SASI_Hs01_00144628 predicted 2911
10 SASI_Hs02_00361832 predicted 3535
11 SASI_Hs01_00144619 predicted 4016
12 SASI_Hs01_00144622 predicted 2703
13 SASI_Hs01_00144623 predicted 4553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350003 predicted 1159
2 SASI_Rn02_00350004 predicted 204
3 SASI_Rn02_00350005 predicted 463
4 SASI_Rn02_00350006 predicted 518
5 SASI_Rn02_00350007 predicted 701
6 SASI_Rn02_00350008 predicted 631
7 SASI_Rn02_00350009 predicted 512
8 SASI_Rn02_00350010 predicted 518
9 SASI_Rn02_00350011 predicted 215
10 SASI_Rn02_00350012 predicted 1056
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053002
VALIDATED
MED12L MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 12-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-521s21c1
Sequence:CCGGGATGACTTGTGCCTATTATTCCTCGAGGAATAATAGGCACAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-4547s21c1
Sequence:CCGGACGATACCAAGATGACATAAACTCGAGTTTATGTCATCTTGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053002.3-7092s21c1
Sequence:CCGGAGATTGTTGCTTCGTACTTAACTCGAGTTAAGTACGAAGCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-4591s21c1
Sequence:CCGGCATTGCAACTCCGCCTAAATTCTCGAGAATTTAGGCGGAGTTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-2558s21c1
Sequence:CCGGACTGAACATCAACGGACTAATCTCGAGATTAGTCCGTTGATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_053002.2-3163s1c1
Sequence:CCGGGCACTGTTCTTAGTTCAGAATCTCGAGATTCTGAACTAAGAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053002.2-233s1c1
Sequence:CCGGCCCATCAAAGATTGGAGCTTACTCGAGTAAGCTCCAATCTTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053002.2-5414s1c1
Sequence:CCGGGCCTCCTAATTACTCGCCTATCTCGAGATAGGCGAGTAATTAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_053002.2-2570s1c1
Sequence:CCGGCGGACTAATTGACTTCGCAATCTCGAGATTGCGAAGTCAATTAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053002.2-4877s1c1
Sequence:CCGGGCGATCAGAAAGTATTGACAACTCGAGTTGTCAATACTTTCTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053002
VALIDATED
MED12L MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 12-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-521s21c1
Sequence:CCGGGATGACTTGTGCCTATTATTCCTCGAGGAATAATAGGCACAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-4547s21c1
Sequence:CCGGACGATACCAAGATGACATAAACTCGAGTTTATGTCATCTTGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053002.3-7092s21c1
Sequence:CCGGAGATTGTTGCTTCGTACTTAACTCGAGTTAAGTACGAAGCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-4591s21c1
Sequence:CCGGCATTGCAACTCCGCCTAAATTCTCGAGAATTTAGGCGGAGTTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-2558s21c1
Sequence:CCGGACTGAACATCAACGGACTAATCTCGAGATTAGTCCGTTGATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_053002.2-3163s1c1
Sequence:CCGGGCACTGTTCTTAGTTCAGAATCTCGAGATTCTGAACTAAGAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053002.2-233s1c1
Sequence:CCGGCCCATCAAAGATTGGAGCTTACTCGAGTAAGCTCCAATCTTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053002.2-5414s1c1
Sequence:CCGGGCCTCCTAATTACTCGCCTATCTCGAGATAGGCGAGTAATTAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_053002.2-2570s1c1
Sequence:CCGGCGGACTAATTGACTTCGCAATCTCGAGATTGCGAAGTCAATTAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053002.2-4877s1c1
Sequence:CCGGGCGATCAGAAAGTATTGACAACTCGAGTTGTCAATACTTTCTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053002
VALIDATED
MED12L MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 12-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-521s21c1
Sequence:CCGGGATGACTTGTGCCTATTATTCCTCGAGGAATAATAGGCACAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-4547s21c1
Sequence:CCGGACGATACCAAGATGACATAAACTCGAGTTTATGTCATCTTGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053002.3-7092s21c1
Sequence:CCGGAGATTGTTGCTTCGTACTTAACTCGAGTTAAGTACGAAGCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-4591s21c1
Sequence:CCGGCATTGCAACTCCGCCTAAATTCTCGAGAATTTAGGCGGAGTTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053002.3-2558s21c1
Sequence:CCGGACTGAACATCAACGGACTAATCTCGAGATTAGTCCGTTGATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_053002.2-3163s1c1
Sequence:CCGGGCACTGTTCTTAGTTCAGAATCTCGAGATTCTGAACTAAGAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053002.2-233s1c1
Sequence:CCGGCCCATCAAAGATTGGAGCTTACTCGAGTAAGCTCCAATCTTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053002.2-5414s1c1
Sequence:CCGGGCCTCCTAATTACTCGCCTATCTCGAGATAGGCGAGTAATTAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_053002.2-2570s1c1
Sequence:CCGGCGGACTAATTGACTTCGCAATCTCGAGATTGCGAAGTCAATTAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053002.2-4877s1c1
Sequence:CCGGGCGATCAGAAAGTATTGACAACTCGAGTTGTCAATACTTTCTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_887994
MED12L MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 12-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-558s21c1
Sequence:GTACCGGGTAAATCAACCCATCCAAGATCTCGAGATCTTGGATGGGTTGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_887994.1-790s21c1
Sequence:CCGGGAGGACGTCTTTGCATATTTACTCGAGTAAATATGCAAAGACGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-605s21c1
Sequence:CCGGCCGAGAAACTGAAGCTTAACACTCGAGTGTTAAGCTTCAGTTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-583s21c1
Sequence:CCGGGCGTATTTCAGCAGCATATTGCTCGAGCAATATGCTGCTGAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-534s21c1
Sequence:CCGGGAACATGGCTCAGCCAGAAACCTCGAGGTTTCTGGCTGAGCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_887994
MED12L MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 12-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-558s21c1
Sequence:GTACCGGGTAAATCAACCCATCCAAGATCTCGAGATCTTGGATGGGTTGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_887994.1-790s21c1
Sequence:CCGGGAGGACGTCTTTGCATATTTACTCGAGTAAATATGCAAAGACGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-605s21c1
Sequence:CCGGCCGAGAAACTGAAGCTTAACACTCGAGTGTTAAGCTTCAGTTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-583s21c1
Sequence:CCGGGCGTATTTCAGCAGCATATTGCTCGAGCAATATGCTGCTGAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-534s21c1
Sequence:CCGGGAACATGGCTCAGCCAGAAACCTCGAGGTTTCTGGCTGAGCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_887994
MED12L MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 12-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-558s21c1
Sequence:GTACCGGGTAAATCAACCCATCCAAGATCTCGAGATCTTGGATGGGTTGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_887994.1-790s21c1
Sequence:CCGGGAGGACGTCTTTGCATATTTACTCGAGTAAATATGCAAAGACGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-605s21c1
Sequence:CCGGCCGAGAAACTGAAGCTTAACACTCGAGTGTTAAGCTTCAGTTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-583s21c1
Sequence:CCGGGCGTATTTCAGCAGCATATTGCTCGAGCAATATGCTGCTGAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_887994.1-534s21c1
Sequence:CCGGGAACATGGCTCAGCCAGAAACCTCGAGGTTTCTGGCTGAGCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks