EMAIL THIS PAGE TO A FRIEND

MEF2BNB-MEF2B

MEF2BNB-MEF2B readthrough

Synonyms: LOC729991-MEF2B MEF2B
Species: Human MEF2BNB-MEF2B(4207)
Gene ID:
Human(4207) Summary: This gene represents numerous read-through transcripts that span GeneID:729991 and 100271849. Many read-through transcripts are predicted to be nonsense-mediated decay (NMD) candidates, and are thought to be non-coding. Some transcripts are predicted to be capable of translation reinitiation at a downstream AUG, resulting in expression of at least one isoform of myocyte enhancer factor 2B (MEF2B) from this read-through locus. At least one additional MEF2B variant and isoform can be expressed from a downstream promoter, and is annotated on GeneID:100271849. [provided by RefSeq, Oct 2010]
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101462 Anti-MEF2B antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4501858 Anti-MEF2B antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB1410780 Anti-MEF2B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2103078 Anti-MEF2B, (N-terminal) antibody produced in rabbit affinity isolated antibody , human, mouse, guinea pig, sheep, horse, canine, zebrafish, pig, rat, rabbit
western blot pricing
WH0004207M1 Monoclonal Anti-MEF2B antibody produced in mouse clone 3E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404065 Monoclonal Anti-MEF2B antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409305 Monoclonal Anti-MEF2B antibody produced in mouse clone 4A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1409306 Monoclonal Anti-MEF2B antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409307 Monoclonal Anti-MEF2B antibody produced in mouse clone 2H7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409308 Monoclonal Anti-MEF2B antibody produced in mouse clone 4B4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409309 Monoclonal Anti-MEF2B antibody produced in mouse clone 1B6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409310 Monoclonal Anti-MEF2B antibody produced in mouse clone 2H4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409311 Monoclonal Anti-MEF2B antibody produced in mouse clone 1B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1409312 Monoclonal Anti-MEF2B antibody produced in mouse clone 4E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005919 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147601 MISSION® esiRNA esiRNA human MEF2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005919 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211821 predicted 998
2 SASI_Hs01_00211822 predicted 1037
3 SASI_Hs01_00211823 predicted 476
4 SASI_Hs01_00211824 predicted 686
5 SASI_Hs01_00211826 predicted 680
6 SASI_Hs01_00211827 predicted 1044
7 SASI_Hs01_00211828 predicted 870
8 SASI_Hs01_00211829 predicted 520
9 SASI_Hs01_00211830 predicted 715
10 SASI_Hs02_00340547 predicted 461
11 SASI_Hs01_00211825 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005919
VALIDATED
MEF2BNB-MEF2B MISSION shRNA Bacterial Glycerol Stock
MEF2BNB-MEF2B readthrough
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005919.1-564s21c1
Sequence:CCGGGTGAGATAGCCCTCATCATCTCTCGAGAGATGATGAGGGCTATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-1272s21c1
Sequence:CCGGCCCAGTCAGCATCAAGTCTGACTCGAGTCAGACTTGATGCTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-1321s21c1
Sequence:CCGGGGCGACTTTCCTAAGACCTTCCTCGAGGAAGGTCTTAGGAAAGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-1103s21c1
Sequence:CCGGGGACTAAACACCTCCAGAAGCCTCGAGGCTTCTGGAGGTGTTTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-833s21c1
Sequence:CCGGTATCCTGCAGCTCCTGCTATGCTCGAGCATAGCAGGAGCTGCAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005919.1-1320s1c1
Sequence:CCGGCGGCGACTTTCCTAAGACCTTCTCGAGAAGGTCTTAGGAAAGTCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-470s1c1
Sequence:CCGGCGCATCCTGGACCAAAGGAATCTCGAGATTCCTTTGGTCCAGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-1037s1c1
Sequence:CCGGCCACTGTACCTGCCGACGGAACTCGAGTTCCGTCGGCAGGTACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-593s1c1
Sequence:CCGGGCCAACCGCCTCTTCCAGTATCTCGAGATACTGGAAGAGGCGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-1514s1c1
Sequence:CCGGGCCTCTTCAGAGAAGACCCAACTCGAGTTGGGTCTTCTCTGAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005919
VALIDATED
MEF2BNB-MEF2B MISSION shRNA shRNA Plasmid DNA
MEF2BNB-MEF2B readthrough
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005919.1-564s21c1
Sequence:CCGGGTGAGATAGCCCTCATCATCTCTCGAGAGATGATGAGGGCTATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-1272s21c1
Sequence:CCGGCCCAGTCAGCATCAAGTCTGACTCGAGTCAGACTTGATGCTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-1321s21c1
Sequence:CCGGGGCGACTTTCCTAAGACCTTCCTCGAGGAAGGTCTTAGGAAAGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-1103s21c1
Sequence:CCGGGGACTAAACACCTCCAGAAGCCTCGAGGCTTCTGGAGGTGTTTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-833s21c1
Sequence:CCGGTATCCTGCAGCTCCTGCTATGCTCGAGCATAGCAGGAGCTGCAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005919.1-1320s1c1
Sequence:CCGGCGGCGACTTTCCTAAGACCTTCTCGAGAAGGTCTTAGGAAAGTCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-470s1c1
Sequence:CCGGCGCATCCTGGACCAAAGGAATCTCGAGATTCCTTTGGTCCAGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-1037s1c1
Sequence:CCGGCCACTGTACCTGCCGACGGAACTCGAGTTCCGTCGGCAGGTACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-593s1c1
Sequence:CCGGGCCAACCGCCTCTTCCAGTATCTCGAGATACTGGAAGAGGCGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-1514s1c1
Sequence:CCGGGCCTCTTCAGAGAAGACCCAACTCGAGTTGGGTCTTCTCTGAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005919
VALIDATED
MEF2BNB-MEF2B MISSION shRNA Lentiviral Transduction Particles
MEF2BNB-MEF2B readthrough
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005919.1-564s21c1
Sequence:CCGGGTGAGATAGCCCTCATCATCTCTCGAGAGATGATGAGGGCTATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-1272s21c1
Sequence:CCGGCCCAGTCAGCATCAAGTCTGACTCGAGTCAGACTTGATGCTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-1321s21c1
Sequence:CCGGGGCGACTTTCCTAAGACCTTCCTCGAGGAAGGTCTTAGGAAAGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-1103s21c1
Sequence:CCGGGGACTAAACACCTCCAGAAGCCTCGAGGCTTCTGGAGGTGTTTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005919.1-833s21c1
Sequence:CCGGTATCCTGCAGCTCCTGCTATGCTCGAGCATAGCAGGAGCTGCAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005919.1-1320s1c1
Sequence:CCGGCGGCGACTTTCCTAAGACCTTCTCGAGAAGGTCTTAGGAAAGTCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-470s1c1
Sequence:CCGGCGCATCCTGGACCAAAGGAATCTCGAGATTCCTTTGGTCCAGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-1037s1c1
Sequence:CCGGCCACTGTACCTGCCGACGGAACTCGAGTTCCGTCGGCAGGTACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-593s1c1
Sequence:CCGGGCCAACCGCCTCTTCCAGTATCTCGAGATACTGGAAGAGGCGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005919.1-1514s1c1
Sequence:CCGGGCCTCTTCAGAGAAGACCCAACTCGAGTTGGGTCTTCTCTGAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks