EMAIL THIS PAGE TO A FRIEND

MEGF8

multiple EGF-like-domains 8

Synonyms: C19orf49 CRPT2 EGFL4 SBP1
UniProtKB ID: Q7Z7M0, A8KAY0, O75097
Gene ID:
Human(1954) Summary: The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(269878) multiple EGF-like-domains 8
Rat(114029) multiple EGF-like-domains 8
Zebrafish(791154) multiple EGF-like-domains 8
cow(790086) EGF-like-domain, multiple 4-like
cow(615688) multiple EGF-like-domains 8
Horse(100146203) multiple EGF-like-domains 8
domestic cat(101085511) multiple EGF-like-domains 8
dog(484474) multiple EGF-like-domains 8
domestic guinea pig(100722321) multiple EGF-like-domains 8
naked mole-rat(101710233) multiple EGF-like-domains 8
sheep(101123065) multiple EGF-like-domains 8
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001160400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001410 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001410 Rosetta Predictions human pricing
XM_001077319 Rosetta Predictions rat pricing
XM_341803 Rosetta Predictions rat pricing
XM_001478642 Rosetta Predictions mouse pricing
XM_194337 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331796 predicted 7206
2 SASI_Hs02_00331797 predicted 871
3 SASI_Hs01_00141884 predicted 2304
4 SASI_Hs02_00331798 predicted 7053
5 SASI_Hs02_00331799 predicted 7057
6 SASI_Hs01_00141887 predicted 6517
7 SASI_Hs02_00331800 predicted 6286
8 SASI_Hs02_00331801 predicted 5042
9 SASI_Hs02_00331802 predicted 1988
10 SASI_Hs02_00331803 predicted 5208
11 SASI_Hs01_00141885 predicted 852
12 SASI_Hs01_00141886 predicted 6044
13 SASI_Hs01_00141888 predicted 418
14 SASI_Hs01_00141889 predicted 5623
15 SASI_Hs01_00141890 predicted 5891
16 SASI_Hs01_00141891 predicted 5054
17 SASI_Hs01_00141892 predicted 908
18 SASI_Hs01_00141893 predicted 4674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356628 predicted 6687
2 SASI_Rn02_00356629 predicted 4555
3 SASI_Rn02_00356630 predicted 1366
4 SASI_Rn02_00356631 predicted 238
5 SASI_Rn02_00356632 predicted 1677
6 SASI_Rn02_00356633 predicted 7332
7 SASI_Rn02_00356634 predicted 2494
8 SASI_Rn02_00356635 predicted 4709
9 SASI_Rn02_00356636 predicted 3198
10 SASI_Rn02_00356637 predicted 7097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393363 predicted 7143
2 SASI_Rn02_00393364 predicted 8802
3 SASI_Rn02_00393365 predicted 1804
4 SASI_Rn02_00393366 predicted 2115
5 SASI_Rn02_00393367 predicted 7786
6 SASI_Rn02_00393368 predicted 2740
7 SASI_Rn02_00393369 predicted 4949
8 SASI_Rn02_00393370 predicted 3437
9 SASI_Rn02_00393371 predicted 381
10 SASI_Rn02_00393372 predicted 7560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00404203 predicted 1879
2 SASI_Mm02_00404204 predicted 451
3 SASI_Mm02_00404205 predicted 8558
4 SASI_Mm02_00404206 predicted 1115
5 SASI_Mm02_00404207 predicted 981
6 SASI_Mm02_00404208 predicted 4706
7 SASI_Mm02_00404209 predicted 549
8 SASI_Mm02_00404210 predicted 4269
9 SASI_Mm02_00404211 predicted 6130
10 SASI_Mm02_00404212 predicted 3409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279654 predicted 1884
2 SASI_Mm01_00279655 predicted 448
3 SASI_Mm02_00425466 predicted 8508
4 SASI_Mm01_00279657 predicted 1117
5 SASI_Mm01_00279658 predicted 977
6 SASI_Mm01_00279659 predicted 4501
7 SASI_Mm02_00425467 predicted 550
8 SASI_Mm01_00279660 predicted 4062
9 SASI_Mm01_00279661 predicted 6085
10 SASI_Mm01_00279662 predicted 3208
11 SASI_Mm01_00279656 predicted 1576
12 SASI_Mm01_00279663 predicted 3932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160400
MEGF8 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 8
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000363914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160400.1-8868s21c1
Sequence:CCGGAGTACAGTTGTGGGTACAAAGCTCGAGCTTTGTACCCACAACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160400.1-1735s21c1
Sequence:CCGGGGGCAATGTGCATACGCATTACTCGAGTAATGCGTATGCACATTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160400.1-1076s21c1
Sequence:CCGGTTTGGAGGCCAGGACCTTAACCTCGAGGTTAAGGTCCTGGCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160400.1-1993s21c1
Sequence:CCGGTCAGGCACCTGCCCTAGATTACTCGAGTAATCTAGGGCAGGTGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160400
MEGF8 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 8
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000363914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160400.1-8868s21c1
Sequence:CCGGAGTACAGTTGTGGGTACAAAGCTCGAGCTTTGTACCCACAACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160400.1-1735s21c1
Sequence:CCGGGGGCAATGTGCATACGCATTACTCGAGTAATGCGTATGCACATTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160400.1-1076s21c1
Sequence:CCGGTTTGGAGGCCAGGACCTTAACCTCGAGGTTAAGGTCCTGGCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160400.1-1993s21c1
Sequence:CCGGTCAGGCACCTGCCCTAGATTACTCGAGTAATCTAGGGCAGGTGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160400
MEGF8 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 8
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000363914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160400.1-8868s21c1
Sequence:CCGGAGTACAGTTGTGGGTACAAAGCTCGAGCTTTGTACCCACAACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160400.1-1735s21c1
Sequence:CCGGGGGCAATGTGCATACGCATTACTCGAGTAATGCGTATGCACATTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160400.1-1076s21c1
Sequence:CCGGTTTGGAGGCCAGGACCTTAACCTCGAGGTTAAGGTCCTGGCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160400.1-1993s21c1
Sequence:CCGGTCAGGCACCTGCCCTAGATTACTCGAGTAATCTAGGGCAGGTGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001410
VALIDATED
MEGF8 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-5381s1c1
Sequence:CCGGCGGCTATACCATGGACAACATCTCGAGATGTTGTCCATGGTATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001410.1-6701s1c1
Sequence:CCGGGTTTGTCTTCTTCTCCGTCTTCTCGAGAAGACGGAGAAGAAGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-5807s1c1
Sequence:CCGGGTGCGTGAACTGCCAGAATAACTCGAGTTATTCTGGCAGTTCACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-3536s1c1
Sequence:CCGGCCGTGATTTCTGGGTCCTCAACTCGAGTTGAGGACCCAGAAATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-843s1c1
Sequence:CCGGCAGCCTGACAAGGTCTCAATTCTCGAGAATTGAGACCTTGTCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001410
VALIDATED
MEGF8 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-5381s1c1
Sequence:CCGGCGGCTATACCATGGACAACATCTCGAGATGTTGTCCATGGTATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001410.1-6701s1c1
Sequence:CCGGGTTTGTCTTCTTCTCCGTCTTCTCGAGAAGACGGAGAAGAAGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-5807s1c1
Sequence:CCGGGTGCGTGAACTGCCAGAATAACTCGAGTTATTCTGGCAGTTCACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-3536s1c1
Sequence:CCGGCCGTGATTTCTGGGTCCTCAACTCGAGTTGAGGACCCAGAAATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-843s1c1
Sequence:CCGGCAGCCTGACAAGGTCTCAATTCTCGAGAATTGAGACCTTGTCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001410
VALIDATED
MEGF8 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-5381s1c1
Sequence:CCGGCGGCTATACCATGGACAACATCTCGAGATGTTGTCCATGGTATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001410.1-6701s1c1
Sequence:CCGGGTTTGTCTTCTTCTCCGTCTTCTCGAGAAGACGGAGAAGAAGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-5807s1c1
Sequence:CCGGGTGCGTGAACTGCCAGAATAACTCGAGTTATTCTGGCAGTTCACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-3536s1c1
Sequence:CCGGCCGTGATTTCTGGGTCCTCAACTCGAGTTGAGGACCCAGAAATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001410.1-843s1c1
Sequence:CCGGCAGCCTGACAAGGTCTCAATTCTCGAGAATTGAGACCTTGTCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks