EMAIL THIS PAGE TO A FRIEND

MEI4

meiosis-specific 4 homolog (S. cerevisiae)

UniProtKB ID: A8MW99
Gene ID:
Mouse(75033) meiosis-specific, MEI4 homolog (S. cerevisiae)
Rat(679805) meiosis-specific, MEI4 homolog (S. cerevisiae)
Zebrafish(568897) meiosis-specific, MEI4 homolog (S. cerevisiae)
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109378 Rosetta Predictions rat pricing
NM_175213 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247826 predicted 1415
2 SASI_Rn02_00247827 predicted 1410
3 SASI_Rn02_00247828 predicted 1208
4 SASI_Rn02_00247829 predicted 668
5 SASI_Rn02_00247830 predicted 979
6 SASI_Rn02_00247831 predicted 938
7 SASI_Rn02_00247832 predicted 1306
8 SASI_Rn02_00247833 predicted 1251
9 SASI_Rn02_00247834 predicted 308
10 SASI_Rn02_00247835 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345881 predicted 1087
2 SASI_Mm02_00345882 predicted 1007
3 SASI_Mm02_00345883 predicted 732
4 SASI_Mm02_00345884 predicted 469
5 SASI_Mm02_00345885 predicted 524
6 SASI_Mm02_00345886 predicted 346
7 SASI_Mm02_00345887 predicted 387
8 SASI_Mm02_00345888 predicted 664
9 SASI_Mm02_00345889 predicted 886
10 SASI_Mm02_00345890 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175213
MEI4 MISSION shRNA Bacterial Glycerol Stock
meiosis-specific 4 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175213.2-630s1c1
Sequence:CCGGGTCTTCTCACATGCAGTTCTTCTCGAGAAGAACTGCATGTGAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175213.2-1034s1c1
Sequence:CCGGCGCTGCTACTATCAGAAGTGACTCGAGTCACTTCTGATAGTAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175213.2-1205s1c1
Sequence:CCGGGCATCCCAGAAATGCAGACATCTCGAGATGTCTGCATTTCTGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175213.2-1273s1c1
Sequence:CCGGCCTTTATTTGCGTTCTACTTACTCGAGTAAGTAGAACGCAAATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175213.2-1549s1c1
Sequence:CCGGGCTCGTGGATTATATCTTATTCTCGAGAATAAGATATAATCCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175213.2-2733s1c1
Sequence:CCGGGCCAGTGTATTTGTGAATATACTCGAGTATATTCACAAATACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175213.2-1506s1c1
Sequence:CCGGCCATATTACAATCAGGCAATTCTCGAGAATTGCCTGATTGTAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175213.2-340s1c1
Sequence:CCGGCTTGAAGCCTTAGAAGCAGAACTCGAGTTCTGCTTCTAAGGCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175213.2-343s1c1
Sequence:CCGGGAAGCCTTAGAAGCAGAAGTTCTCGAGAACTTCTGCTTCTAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175213
MEI4 MISSION shRNA shRNA Plasmid DNA
meiosis-specific 4 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175213.2-630s1c1
Sequence:CCGGGTCTTCTCACATGCAGTTCTTCTCGAGAAGAACTGCATGTGAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175213.2-1034s1c1
Sequence:CCGGCGCTGCTACTATCAGAAGTGACTCGAGTCACTTCTGATAGTAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175213.2-1205s1c1
Sequence:CCGGGCATCCCAGAAATGCAGACATCTCGAGATGTCTGCATTTCTGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175213.2-1273s1c1
Sequence:CCGGCCTTTATTTGCGTTCTACTTACTCGAGTAAGTAGAACGCAAATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175213.2-1549s1c1
Sequence:CCGGGCTCGTGGATTATATCTTATTCTCGAGAATAAGATATAATCCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175213.2-2733s1c1
Sequence:CCGGGCCAGTGTATTTGTGAATATACTCGAGTATATTCACAAATACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175213.2-1506s1c1
Sequence:CCGGCCATATTACAATCAGGCAATTCTCGAGAATTGCCTGATTGTAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175213.2-340s1c1
Sequence:CCGGCTTGAAGCCTTAGAAGCAGAACTCGAGTTCTGCTTCTAAGGCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175213.2-343s1c1
Sequence:CCGGGAAGCCTTAGAAGCAGAAGTTCTCGAGAACTTCTGCTTCTAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175213
MEI4 MISSION shRNA Lentiviral Transduction Particles
meiosis-specific 4 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175213.2-630s1c1
Sequence:CCGGGTCTTCTCACATGCAGTTCTTCTCGAGAAGAACTGCATGTGAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175213.2-1034s1c1
Sequence:CCGGCGCTGCTACTATCAGAAGTGACTCGAGTCACTTCTGATAGTAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175213.2-1205s1c1
Sequence:CCGGGCATCCCAGAAATGCAGACATCTCGAGATGTCTGCATTTCTGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175213.2-1273s1c1
Sequence:CCGGCCTTTATTTGCGTTCTACTTACTCGAGTAAGTAGAACGCAAATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175213.2-1549s1c1
Sequence:CCGGGCTCGTGGATTATATCTTATTCTCGAGAATAAGATATAATCCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175213.2-2733s1c1
Sequence:CCGGGCCAGTGTATTTGTGAATATACTCGAGTATATTCACAAATACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175213.2-1506s1c1
Sequence:CCGGCCATATTACAATCAGGCAATTCTCGAGAATTGCCTGATTGTAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175213.2-340s1c1
Sequence:CCGGCTTGAAGCCTTAGAAGCAGAACTCGAGTTCTGCTTCTAAGGCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175213.2-343s1c1
Sequence:CCGGGAAGCCTTAGAAGCAGAAGTTCTCGAGAACTTCTGCTTCTAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks