EMAIL THIS PAGE TO A FRIEND

MESDC1

mesoderm development candidate 1

UniProtKB ID: Q9H1K6
Gene ID:
Mouse(80889) mesoderm development candidate 1
Rat(308795) mesoderm development candidate 1
chicken(415473) mesoderm development candidate 1
dog(488764) mesoderm development candidate 1
cow(616452) mesoderm development candidate 1
Horse(100052999) mesoderm development candidate 1
domestic guinea pig(100728554) mesoderm development candidate 1
sheep(101109743) mesoderm development candidate 1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA062713 Anti-MESDC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022566 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022566 Rosetta Predictions human pricing
NM_001013149 Rosetta Predictions rat pricing
NM_030705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190557 predicted 1702
2 SASI_Hs01_00190559 predicted 1674
3 SASI_Hs01_00190560 predicted 1580
4 SASI_Hs02_00355858 predicted 1685
5 SASI_Hs01_00190561 predicted 1703
6 SASI_Hs01_00190562 predicted 1803
7 SASI_Hs01_00190564 predicted 1687
8 SASI_Hs01_00190565 predicted 1659
9 SASI_Hs01_00190566 predicted 1275
10 SASI_Hs02_00355859 predicted 1459
11 SASI_Hs01_00190558 predicted 1758
12 SASI_Hs01_00190563 predicted 1766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095691 predicted 656
2 SASI_Rn01_00095692 predicted 728
3 SASI_Rn01_00095693 predicted 414
4 SASI_Rn02_00200876 predicted 402
5 SASI_Rn01_00095694 predicted 991
6 SASI_Rn01_00095695 predicted 933
7 SASI_Rn01_00095696 predicted 1687
8 SASI_Rn01_00095698 predicted 981
9 SASI_Rn02_00200877 predicted 983
10 SASI_Rn01_00095699 predicted 423
11 SASI_Rn01_00095697 predicted 1000
12 SASI_Rn01_00095700 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143850 predicted 2411
2 SASI_Mm01_00143851 predicted 1207
3 SASI_Mm01_00143852 predicted 2174
4 SASI_Mm01_00143853 predicted 2140
5 SASI_Mm01_00143854 predicted 1226
6 SASI_Mm01_00143855 predicted 2494
7 SASI_Mm01_00143856 predicted 1356
8 SASI_Mm01_00143857 predicted 2257
9 SASI_Mm01_00143858 predicted 2319
10 SASI_Mm01_00143859 predicted 2371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030705
MESDC1 MISSION shRNA Bacterial Glycerol Stock
mesoderm development candidate 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030705.2-1627s1c1
Sequence:CCGGGTCTCGAAACCTCAAGTTCCTCTCGAGAGGAACTTGAGGTTTCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030705.2-2883s1c1
Sequence:CCGGCCTAACCATTTCCACTCTAAACTCGAGTTTAGAGTGGAAATGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030705.2-3137s1c1
Sequence:CCGGCCTCCACTCATTTCTCTATTACTCGAGTAATAGAGAAATGAGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-2159s21c1
Sequence:CCGGAGGTCTTCACCCAGGACTTTACTCGAGTAAAGTCCTGGGTGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030705.4-2773s21c1
Sequence:CCGGCTGCATGTACTGGAGTATTTACTCGAGTAAATACTCCAGTACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-1208s21c1
Sequence:CCGGCGGAAGAGGCTGGTATCTATCCTCGAGGATAGATACCAGCCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-2134s21c1
Sequence:CCGGCCTGCTATCTCAGGCTTTAAGCTCGAGCTTAAAGCCTGAGATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-1909s21c1
Sequence:CCGGCTTTGCCACCGAGCCTCAATTCTCGAGAATTGAGGCTCGGTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030705
MESDC1 MISSION shRNA shRNA Plasmid DNA
mesoderm development candidate 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030705.2-1627s1c1
Sequence:CCGGGTCTCGAAACCTCAAGTTCCTCTCGAGAGGAACTTGAGGTTTCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030705.2-2883s1c1
Sequence:CCGGCCTAACCATTTCCACTCTAAACTCGAGTTTAGAGTGGAAATGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030705.2-3137s1c1
Sequence:CCGGCCTCCACTCATTTCTCTATTACTCGAGTAATAGAGAAATGAGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-2159s21c1
Sequence:CCGGAGGTCTTCACCCAGGACTTTACTCGAGTAAAGTCCTGGGTGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030705.4-2773s21c1
Sequence:CCGGCTGCATGTACTGGAGTATTTACTCGAGTAAATACTCCAGTACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-1208s21c1
Sequence:CCGGCGGAAGAGGCTGGTATCTATCCTCGAGGATAGATACCAGCCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-2134s21c1
Sequence:CCGGCCTGCTATCTCAGGCTTTAAGCTCGAGCTTAAAGCCTGAGATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-1909s21c1
Sequence:CCGGCTTTGCCACCGAGCCTCAATTCTCGAGAATTGAGGCTCGGTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030705
MESDC1 MISSION shRNA Lentiviral Transduction Particles
mesoderm development candidate 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030705.2-1627s1c1
Sequence:CCGGGTCTCGAAACCTCAAGTTCCTCTCGAGAGGAACTTGAGGTTTCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030705.2-2883s1c1
Sequence:CCGGCCTAACCATTTCCACTCTAAACTCGAGTTTAGAGTGGAAATGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030705.2-3137s1c1
Sequence:CCGGCCTCCACTCATTTCTCTATTACTCGAGTAATAGAGAAATGAGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-2159s21c1
Sequence:CCGGAGGTCTTCACCCAGGACTTTACTCGAGTAAAGTCCTGGGTGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030705.4-2773s21c1
Sequence:CCGGCTGCATGTACTGGAGTATTTACTCGAGTAAATACTCCAGTACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-1208s21c1
Sequence:CCGGCGGAAGAGGCTGGTATCTATCCTCGAGGATAGATACCAGCCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-2134s21c1
Sequence:CCGGCCTGCTATCTCAGGCTTTAAGCTCGAGCTTAAAGCCTGAGATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030705.4-1909s21c1
Sequence:CCGGCTTTGCCACCGAGCCTCAATTCTCGAGAATTGAGGCTCGGTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022566
MESDC1 MISSION shRNA Bacterial Glycerol Stock
mesoderm development candidate 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2046s1c1
Sequence:CCGGGAAGGAGGTCATGGGTTCATTCTCGAGAATGAACCCATGACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2126s1c1
Sequence:CCGGGACATGGATGTAGCTACCTTTCTCGAGAAAGGTAGCTACATCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-1805s1c1
Sequence:CCGGCCAAAGAAATCATAGGTGAAACTCGAGTTTCACCTATGATTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159430    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2205s1c1
Sequence:CCGGGAAAGAGTATGAATTTGCCATCTCGAGATGGCAAATTCATACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-1761s1c1
Sequence:CCGGCAGACTAAAGGAAGATACTTACTCGAGTAAGTATCTTCCTTTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2011s1c1
Sequence:CCGGCCGGAATTTCTCAACTAAATTCTCGAGAATTTAGTTGAGAAATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162428    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-1760s1c1
Sequence:CCGGCCAGACTAAAGGAAGATACTTCTCGAGAAGTATCTTCCTTTAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2008s1c1
Sequence:CCGGCTTCCGGAATTTCTCAACTAACTCGAGTTAGTTGAGAAATTCCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022566.2-2879s21c1
Sequence:CCGGGTGTGGAAAGAGTATGAATTTCTCGAGAAATTCATACTCTTTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022566.2-2623s21c1
Sequence:CCGGAGGGACTGGAAGATATGTCATCTCGAGATGACATATCTTCCAGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022566.2-2331s21c1
Sequence:CCGGCCCTGCTATCTCAGGCTTTAACTCGAGTTAAAGCCTGAGATAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022566.2-2357s21c1
Sequence:CCGGAGGTCTTCGCCCAGGACTTTACTCGAGTAAAGTCCTGGGCGAAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022566
MESDC1 MISSION shRNA shRNA Plasmid DNA
mesoderm development candidate 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2046s1c1
Sequence:CCGGGAAGGAGGTCATGGGTTCATTCTCGAGAATGAACCCATGACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2126s1c1
Sequence:CCGGGACATGGATGTAGCTACCTTTCTCGAGAAAGGTAGCTACATCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-1805s1c1
Sequence:CCGGCCAAAGAAATCATAGGTGAAACTCGAGTTTCACCTATGATTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159430    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2205s1c1
Sequence:CCGGGAAAGAGTATGAATTTGCCATCTCGAGATGGCAAATTCATACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-1761s1c1
Sequence:CCGGCAGACTAAAGGAAGATACTTACTCGAGTAAGTATCTTCCTTTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2011s1c1
Sequence:CCGGCCGGAATTTCTCAACTAAATTCTCGAGAATTTAGTTGAGAAATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162428    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-1760s1c1
Sequence:CCGGCCAGACTAAAGGAAGATACTTCTCGAGAAGTATCTTCCTTTAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2008s1c1
Sequence:CCGGCTTCCGGAATTTCTCAACTAACTCGAGTTAGTTGAGAAATTCCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022566.2-2879s21c1
Sequence:CCGGGTGTGGAAAGAGTATGAATTTCTCGAGAAATTCATACTCTTTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022566.2-2623s21c1
Sequence:CCGGAGGGACTGGAAGATATGTCATCTCGAGATGACATATCTTCCAGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022566.2-2331s21c1
Sequence:CCGGCCCTGCTATCTCAGGCTTTAACTCGAGTTAAAGCCTGAGATAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022566.2-2357s21c1
Sequence:CCGGAGGTCTTCGCCCAGGACTTTACTCGAGTAAAGTCCTGGGCGAAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022566
MESDC1 MISSION shRNA Lentiviral Transduction Particles
mesoderm development candidate 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2046s1c1
Sequence:CCGGGAAGGAGGTCATGGGTTCATTCTCGAGAATGAACCCATGACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2126s1c1
Sequence:CCGGGACATGGATGTAGCTACCTTTCTCGAGAAAGGTAGCTACATCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-1805s1c1
Sequence:CCGGCCAAAGAAATCATAGGTGAAACTCGAGTTTCACCTATGATTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159430    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2205s1c1
Sequence:CCGGGAAAGAGTATGAATTTGCCATCTCGAGATGGCAAATTCATACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-1761s1c1
Sequence:CCGGCAGACTAAAGGAAGATACTTACTCGAGTAAGTATCTTCCTTTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2011s1c1
Sequence:CCGGCCGGAATTTCTCAACTAAATTCTCGAGAATTTAGTTGAGAAATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162428    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-1760s1c1
Sequence:CCGGCCAGACTAAAGGAAGATACTTCTCGAGAAGTATCTTCCTTTAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022566.1-2008s1c1
Sequence:CCGGCTTCCGGAATTTCTCAACTAACTCGAGTTAGTTGAGAAATTCCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022566.2-2879s21c1
Sequence:CCGGGTGTGGAAAGAGTATGAATTTCTCGAGAAATTCATACTCTTTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022566.2-2623s21c1
Sequence:CCGGAGGGACTGGAAGATATGTCATCTCGAGATGACATATCTTCCAGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022566.2-2331s21c1
Sequence:CCGGCCCTGCTATCTCAGGCTTTAACTCGAGTTAAAGCCTGAGATAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022566.2-2357s21c1
Sequence:CCGGAGGTCTTCGCCCAGGACTTTACTCGAGTAAAGTCCTGGGCGAAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks