EMAIL THIS PAGE TO A FRIEND

MET

met proto-oncogene

Synonyms: AUTS9 HGFR RCCP2 c-Met
Gene ID:
Human(4233) Summary: The proto-oncogene MET product is the hepatocyte growth factor receptor and encodes tyrosine-kinase activity. The primary single chain precursor protein is post-translationally cleaved to produce the alpha and beta subunits, which are disulfide linked to form the mature receptor. Various mutations in the MET gene are associated with papillary renal carcinoma. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17295) met proto-oncogene
Rat(24553) met proto-oncogene
Zebrafish(100150664) met proto-oncogene (hepatocyte growth factor receptor)
chicken(396134) met proto-oncogene (hepatocyte growth factor receptor)
domestic cat(493669) met proto-oncogene (hepatocyte growth factor receptor)
cow(280855) met proto-oncogene (hepatocyte growth factor receptor)
Horse(100056013) met proto-oncogene (hepatocyte growth factor receptor)
dog(403438) met proto-oncogene (hepatocyte growth factor receptor)
fruit fly(32114) Methoprene-tolerant
domestic guinea pig(100135642) met proto-oncogene
domestic guinea pig(100718790) met proto-oncogene (hepatocyte growth factor receptor)
Domestic Rabbit(100126565) met proto-oncogene (hepatocyte growth factor receptor)
naked mole-rat(101725772) met proto-oncogene (hepatocyte growth factor receptor)
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500085 Anti-c-Met (Paired 1003) antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP59, affinity isolated antibody human (tested)
immunohistochemistry pricing
H9786 Anti-Hepatocyte Growth Factor Receptor (c-Met) antibody produced in goat affinity isolated antibody, lyophilized powder human
flow cytometry, immunohistochemistry, western blot pricing
H9911 Anti-Hepatocyte Growth Factor Receptor antibody produced in goat lyophilized powder, affinity isolated antibody mouse
immunohistochemistry, western blot pricing
M5822 Anti-MET (1226-1240) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300599 Anti-MET (Ab-1003) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300479 Anti-MET (Ab-1234) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300487 Anti-MET (Ab-1349) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB1406117 Anti-MET antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4501870 Anti-MET antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing
HPA055607 Anti-MET antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4501868 Anti-MET, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4501869 Anti-MET, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301468 Anti-phospho-c-Met (pTyr1003) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
C7240 Anti-phospho-c-Met (pTyr1230/pTyr1234/pTyr1235) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
western blot pricing
C6990 Anti-phospho-c-Met (pTyr1349) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
C6865 Anti-phospho-c-Met (pTyr1365) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4504471 Anti-phospho-Met (pTyr1234) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300182 Anti-phospho-MET (pTyr1234) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504472 Anti-phospho-Met (pTyr1349) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300190 Anti-phospho-MET (pTyr1349) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4503939 Anti-phospho-Met (pTyr1356) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB1305534 MONOCLONAL ANTI-BI-PHOSPHO-MET/HGFR(Y1234/Y1235) antibody produced in mouse clone 6AT1877, IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP0238 cMet Active human recombinant, expressed in baculovirus infected insect cells, ≥60% (SDS-PAGE) human pricing
H0536 Hepatocyte Growth Factor Receptor (c-Met)/Fc Chimera human >95% (SDS-PAGE), recombinant, expressed in NSO cells, lyophilized powder human pricing
SRP6401 HGFR/c-MET human recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE) human pricing
M0574 MET (956-end), active, GST tagged human PRECISIO® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
SRP5302 MET (M1250T), active, GST tagged human PRECISIO®, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
APREST91664 PrEST Antigen MET Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution New human pricing
QPREST22839 SILuPrEST MET SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22840 SILuPrEST MET SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22841 SILuPrEST MET SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
H0411 Hepatocyte Growth Factor Receptor (c-Met)/Fc Chimera from mouse >95% (SDS-PAGE), recombinant, expressed in baculovirus infected Sf21 cells, lyophilized powder mouse pricing
SRP5049 MET (958-end), active, GST tagged from rat PRECISIO® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000245 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091731 MISSION® esiRNA esiRNA human MET (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABS1916 Anti-c-Met Antibody, clone seeMet 13 100 µL, Detect Hepatocyte growth factor receptor using this mouse monoclonal Anti-c-Met, clone seeMet 13, Cat. No. MABS1916, validated for use in Flow Cytometry, Immunocytochemistry, Immunoprecipitation, and Inhibition studies. pricing
07-283 Anti-Met Antibody 200 µg, Anti-Met Antibody detects level of Met & has been published & validated for use in IP & WB. pricing
MAB3731 Anti-Met/HGFR Antibody, phospho-specific (Tyr1234/1235), clone 6AT1877 100 µg, Anti-Met/HGFR Antibody, phospho-specific (Tyr1234/1235), clone 6AT1877 detects level of Met/HGFR & has been published & validated for use in ELISA. pricing
07-2242 Anti-phospho-c-Met (Tyr1230/1234/1235) Antibody 100 µg, This phospho-c-Met antibody is validated for use in WB & ICC for the detection of the phospho-c-Met protein. pricing
07-807 Anti-phospho-Met (Tyr1003) Antibody 100 µL, Anti-phospho-Met (Tyr1003) Antibody is an antibody against phospho-Met (Tyr1003) for use in WB. pricing
07-810 Anti-phospho-Met (Tyr1230/Tyr1234/Tyr1235) Antibody 100 µL, Anti-phospho-Met (Tyr1230/Tyr1234/Tyr1235) Antibody is an antibody against phospho-Met (Tyr1230/Tyr1234/Tyr1235) for use in IC, IF & WB. pricing
14-818-M Met (D1246N) Protein, active, 10 µg 10 µg, Active, N-terminal 6His-tagged, recombinant, human, Met amino acids 974-end, containing the mutation D1246N, for use in Kinase Assays. pricing
14-526-M Met Protein, active, 10 0 10 µg, Active, N-terminal His6-tagged recombinant human Met residues 974-end, for use in Kinase Assays. pricing
14-805-M Met (Y1248C) Protein, active, 250 µg 250 µg, Active, N-terminal 6His-tagged, recombinant, human, Met amino acids 974-end, containing the mutation Y1248C. For use in Kinase Assays. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000245 siRNAs that have been validated in the lab human pricing
NM_001127500 Rosetta Predictions human pricing
NM_031517 Rosetta Predictions rat pricing
NM_008591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000245 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133002 validated 4187
1 SASI_WI_00000001 validated 758
1 SASI_WI_00000002 validated 3158
2 SASI_Hs01_00133001 predicted 4045
3 SASI_Hs01_00133003 predicted 3613
4 SASI_Hs01_00133004 predicted 1465
5 SASI_Hs01_00133005 predicted 524
6 SASI_Hs01_00133008 predicted 549
7 SASI_Hs01_00133009 predicted 3670
8 SASI_Hs02_00302159 predicted 253
9 SASI_Hs02_00302160 predicted 2888
10 SASI_Hs02_00302161 predicted 4424
11 SASI_Hs01_00133000 predicted 992
12 SASI_Hs01_00133006 predicted 3160
13 SASI_Hs01_00133007 predicted 3689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329694 predicted 4101
2 SASI_Hs02_00329695 predicted 4244
3 SASI_Hs02_00329696 predicted 3670
4 SASI_Hs02_00329697 predicted 1468
5 SASI_Hs02_00329698 predicted 528
6 SASI_Hs02_00329699 predicted 548
7 SASI_Hs02_00329700 predicted 3724
8 SASI_Hs02_00329701 predicted 252
9 SASI_Hs02_00329702 predicted 2942
10 SASI_Hs02_00329703 predicted 4480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040885 predicted 2577
2 SASI_Rn01_00040886 predicted 1299
3 SASI_Rn01_00040888 predicted 1012
4 SASI_Rn01_00040890 predicted 2715
5 SASI_Rn02_00264643 predicted 1731
6 SASI_Rn01_00040892 predicted 2014
7 SASI_Rn01_00040893 predicted 604
8 SASI_Rn02_00264644 predicted 620
9 SASI_Rn02_00264645 predicted 2045
10 SASI_Rn02_00264646 predicted 3691
11 SASI_Rn01_00040887 predicted 1767
12 SASI_Rn01_00040889 predicted 3499
13 SASI_Rn01_00040891 predicted 3162
14 SASI_Rn01_00040894 predicted 2914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095875 predicted 972
2 SASI_Mm01_00095876 predicted 891
3 SASI_Mm01_00095877 predicted 3165
4 SASI_Mm01_00095878 predicted 985
5 SASI_Mm01_00095879 predicted 1586
6 SASI_Mm02_00314229 predicted 2482
7 SASI_Mm01_00095880 predicted 1848
8 SASI_Mm02_00314230 predicted 528
9 SASI_Mm01_00095881 predicted 721
10 SASI_Mm01_00095883 predicted 2096
11 SASI_Mm01_00095874 predicted 3245
12 SASI_Mm01_00095882 predicted 2980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008591
VALIDATED
MET MISSION shRNA Bacterial Glycerol Stock
met proto-oncogene
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008591.2-522s21c1
Sequence:CCGGTCCTACACGGCCATCATATTTCTCGAGAAATATGATGGCCGTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-2193s21c1
Sequence:CCGGTAAGCGAGAGCACGACAAATACTCGAGTATTTGTCGTGCTCTCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-1037s21c1
Sequence:CCGGTTGACAGACCAGTCCTATATTCTCGAGAATATAGGACTGGTCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-5478s21c1
Sequence:GTACCGGATAAGTAACTTGCGGTGATAACTCGAGTTATCACCGCAAGTTACTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-3832s21c1
Sequence:CCGGGCATGGAGATCTGCGAAATTTCTCGAGAAATTTCGCAGATCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-2469s1c1
Sequence:CCGGCGGGATTCTTTCCAAACACTTCTCGAGAAGTGTTTGGAAAGAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-3847s1c1
Sequence:CCGGCCCGACGTGAACACATTTGATCTCGAGATCAAATGTGTTCACGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-1847s1c1
Sequence:CCGGGCACGACAAATACGTTGAAATCTCGAGATTTCAACGTATTTGTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-3326s1c1
Sequence:CCGGCCTTGAATAGAATCACAGATACTCGAGTATCTGTGATTCTATTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008591
VALIDATED
MET MISSION shRNA shRNA Plasmid DNA
met proto-oncogene
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008591.2-522s21c1
Sequence:CCGGTCCTACACGGCCATCATATTTCTCGAGAAATATGATGGCCGTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-2193s21c1
Sequence:CCGGTAAGCGAGAGCACGACAAATACTCGAGTATTTGTCGTGCTCTCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-1037s21c1
Sequence:CCGGTTGACAGACCAGTCCTATATTCTCGAGAATATAGGACTGGTCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-5478s21c1
Sequence:GTACCGGATAAGTAACTTGCGGTGATAACTCGAGTTATCACCGCAAGTTACTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-3832s21c1
Sequence:CCGGGCATGGAGATCTGCGAAATTTCTCGAGAAATTTCGCAGATCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-2469s1c1
Sequence:CCGGCGGGATTCTTTCCAAACACTTCTCGAGAAGTGTTTGGAAAGAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-3847s1c1
Sequence:CCGGCCCGACGTGAACACATTTGATCTCGAGATCAAATGTGTTCACGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-1847s1c1
Sequence:CCGGGCACGACAAATACGTTGAAATCTCGAGATTTCAACGTATTTGTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-3326s1c1
Sequence:CCGGCCTTGAATAGAATCACAGATACTCGAGTATCTGTGATTCTATTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008591
VALIDATED
MET MISSION shRNA Lentiviral Transduction Particles
met proto-oncogene
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008591.2-522s21c1
Sequence:CCGGTCCTACACGGCCATCATATTTCTCGAGAAATATGATGGCCGTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-2193s21c1
Sequence:CCGGTAAGCGAGAGCACGACAAATACTCGAGTATTTGTCGTGCTCTCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-1037s21c1
Sequence:CCGGTTGACAGACCAGTCCTATATTCTCGAGAATATAGGACTGGTCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-5478s21c1
Sequence:GTACCGGATAAGTAACTTGCGGTGATAACTCGAGTTATCACCGCAAGTTACTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008591.2-3832s21c1
Sequence:CCGGGCATGGAGATCTGCGAAATTTCTCGAGAAATTTCGCAGATCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-2469s1c1
Sequence:CCGGCGGGATTCTTTCCAAACACTTCTCGAGAAGTGTTTGGAAAGAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-3847s1c1
Sequence:CCGGCCCGACGTGAACACATTTGATCTCGAGATCAAATGTGTTCACGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-1847s1c1
Sequence:CCGGGCACGACAAATACGTTGAAATCTCGAGATTTCAACGTATTTGTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008591.1-3326s1c1
Sequence:CCGGCCTTGAATAGAATCACAGATACTCGAGTATCTGTGATTCTATTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000245
VALIDATED
MET MISSION shRNA Bacterial Glycerol Stock
met proto-oncogene
Human
28 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4191s1c1
Sequence:CCGGCCCGGATATCAGCGATCTTCTCTCGAGAGAAGATCGCTGATATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-2829s1c1
Sequence:CCGGGCTGTGAGAATATACACTTACCTCGAGGTAAGTGTATATTCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-1493s1c1
Sequence:CCGGGAAGTCCTCTTAACATCTATACTCGAGTATAGATGTTAAGAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-1469s1c1
Sequence:CCGGGACTTATTCATGGGTCAATTCCTCGAGGAATTGACCCATGAATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4799s1c1
Sequence:CCGGGTGTGTTGTATGGTCAATAACCTCGAGGTTATTGACCATACAACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000245.2-5997s1c1
Sequence:CCGGGATAAGGAAATGTACTGATTGCTCGAGCAATCAGTACATTTCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.x-4571s1c1
Sequence:CCGGCATCAGAACCAGAGGCTTGGTCTCGAGACCAAGCCTCTGGTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.x-1651s1c1
Sequence:CCGGCAGAAGTGATTGTGGAGCATACTCGAGTATGCTCCACAATCACTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.x-1374s1c1
Sequence:CCGGCACTGCTTTAATAGGACACTTCTCGAGAAGTGTCCTATTAAAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.x-3075s1c1
Sequence:CCGGCTGTTATTACTACTTGGGTTTCTCGAGAAACCCAAGTAGTAATAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000245.x-4490s1c1
Sequence:CCGGTCGATATTCTTTGCTCCTTGCCTCGAGGCAAGGAGCAAAGAATATCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.x-345s1c1
Sequence:CCGGCAGAATGTCATTCTACATGAGCTCGAGCTCATGTAGAATGACATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-1809s1c1
Sequence:CCGGGCCACGACAAATGTGTGCGATCTCGAGATCGCACACATTTGTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-3120s1c1
Sequence:CCGGCTCATTTGGATAGGCTTGTAACTCGAGTTACAAGCCTATCCAAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-765s1c1
Sequence:CCGGTCAACTTCTTTGTAGGCAATACTCGAGTATTGCCTACAAAGAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4462s1c1
Sequence:CCGGGCACTATTATAGGACTTGTATCTCGAGATACAAGTCCTATAATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-3702s1c1
Sequence:CCGGAGACTCATAATCCAACTGTAACTCGAGTTACAGTTGGATTATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-4040s1c1
Sequence:CCGGCCTGACGTAAACACCTTTGATCTCGAGATCAAAGGTGTTTACGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-2552s1c1
Sequence:CCGGGCATGTCAACATCGCTCTAATCTCGAGATTAGAGCGATGTTGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4118s1c1
Sequence:CCGGCCCTTATATGAAGTAATGCTACTCGAGTAGCATTACTTCATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-1035s1c1
Sequence:CCGGCCATAAACTCTGGATTGCATTCTCGAGAATGCAATCCAGAGTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000245.2-4592s1c1
Sequence:CCGGCCTGTCATATTGGAGTCCAAACTCGAGTTTGGACTCCAATATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-2401s1c1
Sequence:CCGGCCGTGAAGATCCCATTGTCTACTCGAGTAGACAATGGGATCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4387s1c1
Sequence:CCGGCCACACTTTGTCCAATGGTTTCTCGAGAAACCATTGGACAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-628s1c1
Sequence:CCGGCCACAATCATACTGCTGACATCTCGAGATGTCAGCAGTATGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-418s1c1
Sequence:CCGGCCTTCAGAAGGTTGCTGAGTACTCGAGTACTCAGCAACCTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.1-1190s1c1
Sequence:CCGGGCCAGCCTGAATGATGACATTCTCGAGAATGTCATCATTCAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.1-2037s1c1
Sequence:CCGGGCACGATGAATACATTGAAATCTCGAGATTTCAATGTATTCATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000245
VALIDATED
MET MISSION shRNA shRNA Plasmid DNA
met proto-oncogene
Human
28 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4191s1c1
Sequence:CCGGCCCGGATATCAGCGATCTTCTCTCGAGAGAAGATCGCTGATATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-2829s1c1
Sequence:CCGGGCTGTGAGAATATACACTTACCTCGAGGTAAGTGTATATTCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-1493s1c1
Sequence:CCGGGAAGTCCTCTTAACATCTATACTCGAGTATAGATGTTAAGAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-1469s1c1
Sequence:CCGGGACTTATTCATGGGTCAATTCCTCGAGGAATTGACCCATGAATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4799s1c1
Sequence:CCGGGTGTGTTGTATGGTCAATAACCTCGAGGTTATTGACCATACAACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000245.2-5997s1c1
Sequence:CCGGGATAAGGAAATGTACTGATTGCTCGAGCAATCAGTACATTTCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.x-4571s1c1
Sequence:CCGGCATCAGAACCAGAGGCTTGGTCTCGAGACCAAGCCTCTGGTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.x-1651s1c1
Sequence:CCGGCAGAAGTGATTGTGGAGCATACTCGAGTATGCTCCACAATCACTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.x-1374s1c1
Sequence:CCGGCACTGCTTTAATAGGACACTTCTCGAGAAGTGTCCTATTAAAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.x-3075s1c1
Sequence:CCGGCTGTTATTACTACTTGGGTTTCTCGAGAAACCCAAGTAGTAATAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000245.x-4490s1c1
Sequence:CCGGTCGATATTCTTTGCTCCTTGCCTCGAGGCAAGGAGCAAAGAATATCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.x-345s1c1
Sequence:CCGGCAGAATGTCATTCTACATGAGCTCGAGCTCATGTAGAATGACATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-1809s1c1
Sequence:CCGGGCCACGACAAATGTGTGCGATCTCGAGATCGCACACATTTGTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-3120s1c1
Sequence:CCGGCTCATTTGGATAGGCTTGTAACTCGAGTTACAAGCCTATCCAAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-765s1c1
Sequence:CCGGTCAACTTCTTTGTAGGCAATACTCGAGTATTGCCTACAAAGAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4462s1c1
Sequence:CCGGGCACTATTATAGGACTTGTATCTCGAGATACAAGTCCTATAATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-3702s1c1
Sequence:CCGGAGACTCATAATCCAACTGTAACTCGAGTTACAGTTGGATTATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-4040s1c1
Sequence:CCGGCCTGACGTAAACACCTTTGATCTCGAGATCAAAGGTGTTTACGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-2552s1c1
Sequence:CCGGGCATGTCAACATCGCTCTAATCTCGAGATTAGAGCGATGTTGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4118s1c1
Sequence:CCGGCCCTTATATGAAGTAATGCTACTCGAGTAGCATTACTTCATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-1035s1c1
Sequence:CCGGCCATAAACTCTGGATTGCATTCTCGAGAATGCAATCCAGAGTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000245.2-4592s1c1
Sequence:CCGGCCTGTCATATTGGAGTCCAAACTCGAGTTTGGACTCCAATATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-2401s1c1
Sequence:CCGGCCGTGAAGATCCCATTGTCTACTCGAGTAGACAATGGGATCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4387s1c1
Sequence:CCGGCCACACTTTGTCCAATGGTTTCTCGAGAAACCATTGGACAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-628s1c1
Sequence:CCGGCCACAATCATACTGCTGACATCTCGAGATGTCAGCAGTATGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-418s1c1
Sequence:CCGGCCTTCAGAAGGTTGCTGAGTACTCGAGTACTCAGCAACCTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.1-1190s1c1
Sequence:CCGGGCCAGCCTGAATGATGACATTCTCGAGAATGTCATCATTCAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.1-2037s1c1
Sequence:CCGGGCACGATGAATACATTGAAATCTCGAGATTTCAATGTATTCATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000245
VALIDATED
MET MISSION shRNA Lentiviral Transduction Particles
met proto-oncogene
Human
28 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4191s1c1
Sequence:CCGGCCCGGATATCAGCGATCTTCTCTCGAGAGAAGATCGCTGATATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-2829s1c1
Sequence:CCGGGCTGTGAGAATATACACTTACCTCGAGGTAAGTGTATATTCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-1493s1c1
Sequence:CCGGGAAGTCCTCTTAACATCTATACTCGAGTATAGATGTTAAGAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-1469s1c1
Sequence:CCGGGACTTATTCATGGGTCAATTCCTCGAGGAATTGACCCATGAATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4799s1c1
Sequence:CCGGGTGTGTTGTATGGTCAATAACCTCGAGGTTATTGACCATACAACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000245.2-5997s1c1
Sequence:CCGGGATAAGGAAATGTACTGATTGCTCGAGCAATCAGTACATTTCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.x-4571s1c1
Sequence:CCGGCATCAGAACCAGAGGCTTGGTCTCGAGACCAAGCCTCTGGTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.x-1651s1c1
Sequence:CCGGCAGAAGTGATTGTGGAGCATACTCGAGTATGCTCCACAATCACTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.x-1374s1c1
Sequence:CCGGCACTGCTTTAATAGGACACTTCTCGAGAAGTGTCCTATTAAAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.x-3075s1c1
Sequence:CCGGCTGTTATTACTACTTGGGTTTCTCGAGAAACCCAAGTAGTAATAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000245.x-4490s1c1
Sequence:CCGGTCGATATTCTTTGCTCCTTGCCTCGAGGCAAGGAGCAAAGAATATCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.x-345s1c1
Sequence:CCGGCAGAATGTCATTCTACATGAGCTCGAGCTCATGTAGAATGACATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-1809s1c1
Sequence:CCGGGCCACGACAAATGTGTGCGATCTCGAGATCGCACACATTTGTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-3120s1c1
Sequence:CCGGCTCATTTGGATAGGCTTGTAACTCGAGTTACAAGCCTATCCAAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-765s1c1
Sequence:CCGGTCAACTTCTTTGTAGGCAATACTCGAGTATTGCCTACAAAGAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4462s1c1
Sequence:CCGGGCACTATTATAGGACTTGTATCTCGAGATACAAGTCCTATAATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-3702s1c1
Sequence:CCGGAGACTCATAATCCAACTGTAACTCGAGTTACAGTTGGATTATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-4040s1c1
Sequence:CCGGCCTGACGTAAACACCTTTGATCTCGAGATCAAAGGTGTTTACGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-2552s1c1
Sequence:CCGGGCATGTCAACATCGCTCTAATCTCGAGATTAGAGCGATGTTGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4118s1c1
Sequence:CCGGCCCTTATATGAAGTAATGCTACTCGAGTAGCATTACTTCATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-1035s1c1
Sequence:CCGGCCATAAACTCTGGATTGCATTCTCGAGAATGCAATCCAGAGTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000245.2-4592s1c1
Sequence:CCGGCCTGTCATATTGGAGTCCAAACTCGAGTTTGGACTCCAATATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-2401s1c1
Sequence:CCGGCCGTGAAGATCCCATTGTCTACTCGAGTAGACAATGGGATCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-4387s1c1
Sequence:CCGGCCACACTTTGTCCAATGGTTTCTCGAGAAACCATTGGACAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000245.2-628s1c1
Sequence:CCGGCCACAATCATACTGCTGACATCTCGAGATGTCAGCAGTATGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.2-418s1c1
Sequence:CCGGCCTTCAGAAGGTTGCTGAGTACTCGAGTACTCAGCAACCTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.1-1190s1c1
Sequence:CCGGGCCAGCCTGAATGATGACATTCTCGAGAATGTCATCATTCAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000245.1-2037s1c1
Sequence:CCGGGCACGATGAATACATTGAAATCTCGAGATTTCAATGTATTCATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks